Regulon of PtsR in Bifidobacterium longum subsp. infantis ATCC 15697

Properties
Regulator type:	Transcription factor
TF locus tag:	Blon_0176
Regulator family:	LacI
Regulation mode:
Biological process:	Carbohydrate metabolism
Effector:
Regulog:	PtsR - Bifidobacteriaceae
Statistics of regulated genes:
- Genes	3
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 13 sites [see more]

Member of regulog collections

By taxonomy - Bifidobacteriaceae
By TF family - LacI
By pathway - Carbohydrate metabolism

Regulated operons
	Locus Tag	Name	Function
Position: -164 Score: 5.9 Sequence: TCCAGAAAACGATTACCGTT Locus tag: Blon_0178 Name: ptsI Funciton: PTS system, enzyme I
	Blon_0178	ptsI	PTS system, enzyme I
Position: -112 Score: 5.9 Sequence: AACGGTAATCGTTTTCTGGA Locus tag: Blon_0177 Name: hpr Funciton: Phosphotransferase system, phosphocarrier HPr protein Locus tag: Blon_0176 Name: ptsR Funciton: Transcriptional regulator of general components of PTS, LacI family
	Blon_0177	hpr	Phosphotransferase system, phosphocarrier HPr protein
	Blon_0176	ptsR	Transcriptional regulator of general components of PTS, LacI family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD