Regulon of PtsR in Bifidobacterium gallicum DSM 20093

Properties
Regulator type:	Transcription factor
TF locus tag:	BIFGAL_00153
Regulator family:	LacI
Regulation mode:
Biological process:	Carbohydrate metabolism
Effector:
Regulog:	PtsR - Bifidobacteriaceae
Statistics of regulated genes:
- Genes	2
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 13 sites [see more]

Member of regulog collections

By taxonomy - Bifidobacteriaceae
By TF family - LacI
By pathway - Carbohydrate metabolism

Regulated operons
	Locus Tag	Name	Function
Position: -234 Score: 5.4 Sequence: AGCGGTAATCGTTTTCTAGG Locus tag: BIFGAL_00155 Name: hpr Funciton: Phosphotransferase system, phosphocarrier HPr protein
	BIFGAL_00155	hpr	Phosphotransferase system, phosphocarrier HPr protein
Position: -255 Score: 5.4 Sequence: CCTAGAAAACGATTACCGCT Locus tag: BIFGAL_00157 Name: ptsI Funciton: PTS system, enzyme I
	BIFGAL_00157	ptsI	PTS system, enzyme I

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD