Regulog BDP_2100 - Bifidobacteriaceae
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | |
| Biological process: | Carbohydrate metabolism |
| Effector: | |
| Phylum: | Actinobacteria |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Bifidobacteriaceae
- By TF family - LacI
- By pathway - Carbohydrate metabolism
| Genome | Genes | Operons |
|---|---|---|
| Bifidobacterium longum subsp. infantis ATCC 15697 | ||
| Bifidobacterium adolescentis ATCC 15703 | ||
| Bifidobacterium angulatum DSM 20098 | ||
| Bifidobacterium animalis subsp. lactis AD011 | ||
| Bifidobacterium bifidum NCIMB 41171 | ||
| Bifidobacterium breve DSM 20213 | 5 | 1 |
| Bifidobacterium dentium Bd1 | 5 | 2 |
| Bifidobacterium gallicum DSM 20093 | ||
| Bifidobacterium longum NCC2705 | ||
| Gardnerella vaginalis 409-05 |
| Genes | Function | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||||
| BDP_2099 |
|
|
|
|
|
|
*
Bifidobacterium dentium Bd1 Site: position = -46 score = 6.98118 sequence = GAAAATAAACGTTTAGCATA Gene: BDP_2099: Anhydro-N-acetylmuramic acid kinase |
|
|
|
Anhydro-N-acetylmuramic acid kinase |
| BDP_2098 |
|
|
|
|
|
|
Gene: BDP_2098: ABC-type sugar transport system, ATPase component |
|
|
|
ABC-type sugar transport system, ATPase component |
| BDP_2097 |
|
|
|
|
|
|
Gene: BDP_2097: ABC-type sugar transport system, permease component |
|
|
|
ABC-type sugar transport system, permease component |
| BDP_2096 |
|
|
|
|
|
|
Gene: BDP_2096: ABC-type sugar transport system, substrate-binding component |
|
|
|
ABC-type sugar transport system, substrate-binding component |
| CRON 2. | |||||||||||
| BIFBRE_00641 |
|
|
|
|
|
*
Bifidobacterium breve DSM 20213 Site: position = -22 score = 6.72955 sequence = AAAAATAAACGTTTAGGATT Gene: BIFBRE_00641: Transcriptional regulator, LacI family |
*
Bifidobacterium dentium Bd1 Site: position = -86 score = 4.62989 sequence = CATGCTAAACGTTTGTGATA Site: position = -57 score = 6.47792 sequence = CATCACAAACGTTTAGCAAA Gene: BDP_2100: Transcriptional regulator, LacI family |
|
|
|
Transcriptional regulator, LacI family |
| BIFBRE_00642 |
|
|
|
|
|
Gene: BIFBRE_00642: ABC-type transport system, substrate-binding component |
|
|
|
|
ABC-type transport system, substrate-binding component |
| BIFBRE_00643 |
|
|
|
|
|
Gene: BIFBRE_00643: ABC-type transport system, ATPase component |
|
|
|
|
ABC-type transport system, ATPase component |
| BIFBRE_00644 |
|
|
|
|
|
Gene: BIFBRE_00644: ABC-type transport system, permease component |
|
|
|
|
ABC-type transport system, permease component |
| BIFBRE_00645 |
|
|
|
|
|
Gene: BIFBRE_00645: hypothetical protein |
|
|
|
|
hypothetical protein |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |