Regulon of BDP_2100 in Bifidobacterium dentium Bd1

Properties
Regulator type:	Transcription factor
TF locus tag:	BDP_2100
Regulator family:	LacI
Regulation mode:
Biological process:	Carbohydrate metabolism
Effector:
Regulog:	BDP_2100 - Bifidobacteriaceae
Statistics of regulated genes:
- Genes	5
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 4 sites [see more]

Member of regulog collections

By taxonomy - Bifidobacteriaceae
By TF family - LacI
By pathway - Carbohydrate metabolism

Regulated operons
	Locus Tag	Name	Function
Position: -86 Score: 4.6 Sequence: CATGCTAAACGTTTGTGATA Position: -57 Score: 6.5 Sequence: CATCACAAACGTTTAGCAAA Locus tag: BDP_2100 Name: null Funciton: Transcriptional regulator, LacI family
	BDP_2100		Transcriptional regulator, LacI family
Position: -46 Score: 7 Sequence: GAAAATAAACGTTTAGCATA Locus tag: BDP_2099 Name: null Funciton: Anhydro-N-acetylmuramic acid kinase Locus tag: BDP_2098 Name: BDP_2098 Funciton: ABC-type sugar transport system, ATPase component Locus tag: BDP_2097 Name: BDP_2097 Funciton: ABC-type sugar transport system, permease component Locus tag: BDP_2096 Name: BDP_2096 Funciton: ABC-type sugar transport system, substrate-binding component
	BDP_2099		Anhydro-N-acetylmuramic acid kinase
	BDP_2098	BDP_2098	ABC-type sugar transport system, ATPase component
	BDP_2097	BDP_2097	ABC-type sugar transport system, permease component
	BDP_2096	BDP_2096	ABC-type sugar transport system, substrate-binding component

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD