Profile of regulator BDP_2100 in Bifidobacteriaceae
| Regulator family: | LacI |
| Regulation mode: | |
| Biological process: | Carbohydrate metabolism |
| Effector: | |
| Regulog: | BDP_2100 - Bifidobacteriaceae |
Member of regulog collections
- By taxonomy - Bifidobacteriaceae
- By TF family - LacI
- By pathway - Carbohydrate metabolism
Transcription factor binding sites
| Locus Tag | Name | Position | Score | Sequence | |
|---|---|---|---|---|---|
| Bifidobacterium breve DSM 20213 | |||||
| BIFBRE_00641 | null | -22 | 6.7 | AAAAATAAACGTTTAGGATT | |
| Bifidobacterium dentium Bd1 | |||||
| BDP_2100 | null | -86 | 4.6 | CATGCTAAACGTTTGTGATA | |
| BDP_2100 | null | -57 | 6.5 | CATCACAAACGTTTAGCAAA | |
| BDP_2099 | null | -46 | 7 | GAAAATAAACGTTTAGCATA | |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |