Regulon of BDP_2100 in Bifidobacterium breve DSM 20213

Properties
Regulator type:	Transcription factor
TF locus tag:	BIFBRE_00641
Regulator family:	LacI
Regulation mode:
Biological process:	Carbohydrate metabolism
Effector:
Regulog:	BDP_2100 - Bifidobacteriaceae
Statistics of regulated genes:
- Genes	5
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 4 sites [see more]

Member of regulog collections

By taxonomy - Bifidobacteriaceae
By TF family - LacI
By pathway - Carbohydrate metabolism

Regulated operons
	Locus Tag	Name	Function
Position: -22 Score: 6.7 Sequence: AAAAATAAACGTTTAGGATT Locus tag: BIFBRE_00641 Name: null Funciton: Transcriptional regulator, LacI family Locus tag: BIFBRE_00642 Name: null Funciton: ABC-type transport system, substrate-binding component Locus tag: BIFBRE_00643 Name: null Funciton: ABC-type transport system, ATPase component Locus tag: BIFBRE_00644 Name: null Funciton: ABC-type transport system, permease component Locus tag: BIFBRE_00645 Name: null Funciton: hypothetical protein
	BIFBRE_00641		Transcriptional regulator, LacI family
	BIFBRE_00642		ABC-type transport system, substrate-binding component
	BIFBRE_00643		ABC-type transport system, ATPase component
	BIFBRE_00644		ABC-type transport system, permease component
	BIFBRE_00645		hypothetical protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD