Regulon of BDP_2100 in Bifidobacterium breve DSM 20213
| Regulator type: | Transcription factor |
| TF locus tag: | BIFBRE_00641 |
| Regulator family: | LacI |
| Regulation mode: | |
| Biological process: | Carbohydrate metabolism |
| Effector: | |
| Regulog: | BDP_2100 - Bifidobacteriaceae |
| Statistics of regulated genes: | |
| - Genes | 5 |
| - Operons | 1 |
| Visualization: | |
|
Allows to visualize regulon content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Bifidobacteriaceae
- By TF family - LacI
- By pathway - Carbohydrate metabolism
| Locus Tag | Name | Function | |
|---|---|---|---|
|
Position: -22
Score: 6.7 Sequence: AAAAATAAACGTTTAGGATT
Locus tag: BIFBRE_00641
Name: null Funciton: Transcriptional regulator, LacI family
Locus tag: BIFBRE_00642
Name: null Funciton: ABC-type transport system, substrate-binding component
Locus tag: BIFBRE_00643
Name: null Funciton: ABC-type transport system, ATPase component
Locus tag: BIFBRE_00644
Name: null Funciton: ABC-type transport system, permease component
Locus tag: BIFBRE_00645
Name: null Funciton: hypothetical protein |
|||
|
Transcriptional regulator, LacI family
|
|||
|
ABC-type transport system, substrate-binding component
|
|||
|
ABC-type transport system, ATPase component
|
|||
|
ABC-type transport system, permease component
|
|||
|
hypothetical protein
|
|||
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |