Regulog CzrA - Staphylococcaceae
| Regulator type: | Transcription factor |
| Regulator family: | ArsR |
| Regulation mode: | repressor |
| Biological process: | Zinc resistance |
| Effector: | Zinc ion, (Zn2+) |
| Phylum: | Firmicutes |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Staphylococcaceae
- By trascription factor - CzrA
- By TF family - ArsR
- By effector - Zinc ion, (Zn2+)
- By pathway - Zinc resistance
| Genome | Genes | Operons |
|---|---|---|
| Staphylococcus aureus subsp. aureus N315 | 2 | 1 |
| Staphylococcus capitis SK14 | 2 | 1 |
| Staphylococcus epidermidis ATCC 12228 | 2 | 1 |
| Staphylococcus carnosus subsp. carnosus TM300 | 2 | 1 |
| Staphylococcus haemolyticus JCSC1435 | 2 | 1 |
| Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305 | 2 | 1 |
| Macrococcus caseolyticus JCSC5402 |
| Genes | Function | |||||||
|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||
| czrA |
*
Staphylococcus aureus subsp. aureus N315 Site: position = -40 score = 7.33318 sequence = AATATATGAACAAATATTCATATGAA Gene: SA1947: zinc resistance repressor |
*
Staphylococcus capitis SK14 Site: position = -39 score = 7.5655 sequence = AATATATGAACAAATATTCATATAAA Gene: STACA0001_0851: zinc resistance repressor |
*
Staphylococcus epidermidis ATCC 12228 Site: position = -21 score = 7.68817 sequence = AATATATGAACAAATATTCATATGTT Gene: SE1746: zinc resistance repressor |
*
Staphylococcus carnosus subsp. carnosus TM300 Site: position = -45 score = 7.54919 sequence = TATATATGAATAGTTGTTCATATATT Gene: Sca_1651: zinc resistance repressor |
*
Staphylococcus haemolyticus JCSC1435 Site: position = -41 score = 7.98352 sequence = AATATATGAACATATATTCATATATT Gene: SH0889: zinc resistance repressor |
*
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305 Site: position = -52 score = 7.92048 sequence = AATATATGAACAAATATTCATATATT Gene: SSP0736: zinc resistance repressor |
|
zinc resistance repressor |
| czrB |
Gene: SA1948: zinc resistance efflux pump |
Gene: STACA0001_0852: zinc resistance efflux pump |
Gene: SE1747: zinc resistance efflux pump |
Gene: Sca_1652: zinc resistance efflux pump |
Gene: SH0888: zinc resistance efflux pump |
Gene: SSP0735: zinc resistance efflux pump |
|
zinc resistance efflux pump |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |