Regulon of CzrA in Staphylococcus capitis SK14
Regulator type: | Transcription factor |
TF locus tag: | STACA0001_0851 |
Regulator family: | ArsR |
Regulation mode: | repressor |
Biological process: | Zinc resistance |
Effector: | Zinc ion, (Zn2+) |
Regulog: | CzrA - Staphylococcaceae |
Statistics of regulated genes: | |
- Genes | 2 |
- Operons | 1 |
Visualization: | |
![]() |
Allows to visualize regulon content in the context of metabolic pathways |

Member of regulog collections
- By taxonomy - Staphylococcaceae
- By trascription factor - CzrA
- By TF family - ArsR
- By effector - Zinc ion, (Zn2+)
- By pathway - Zinc resistance
Locus Tag | Name | Function | |
---|---|---|---|
Position: -39
Score: 7.6 Sequence: AATATATGAACAAATATTCATATAAA
Locus tag: STACA0001_0851
Name: czrA Funciton: zinc resistance repressor
Locus tag: STACA0001_0852
Name: czrB Funciton: zinc resistance efflux pump |
|||
czrA
|
zinc resistance repressor
|
||
czrB
|
zinc resistance efflux pump
|
![]() |
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
![]() |
Regulatory Sites | [ FASTA format ] | DOWNLOAD |