Regulon of CzrA in Staphylococcus haemolyticus JCSC1435
| Regulator type: | Transcription factor |
| TF locus tag: | SH0889 |
| Regulator family: | ArsR |
| Regulation mode: | repressor |
| Biological process: | Zinc resistance |
| Effector: | Zinc ion, (Zn2+) |
| Regulog: | CzrA - Staphylococcaceae |
| Statistics of regulated genes: | |
| - Genes | 2 |
| - Operons | 1 |
| Visualization: | |
|
Allows to visualize regulon content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Staphylococcaceae
- By trascription factor - CzrA
- By TF family - ArsR
- By effector - Zinc ion, (Zn2+)
- By pathway - Zinc resistance
| Locus Tag | Name | Function | |
|---|---|---|---|
|
Position: -41
Score: 8 Sequence: AATATATGAACATATATTCATATATT
Locus tag: SH0889
Name: czrA Funciton: zinc resistance repressor
Locus tag: SH0888
Name: czrB Funciton: zinc resistance efflux pump |
|||
|
czrA
|
zinc resistance repressor
|
||
|
czrB
|
zinc resistance efflux pump
|
||
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |