Regulon of CzrA in Staphylococcus epidermidis ATCC 12228

Properties
Regulator type:	Transcription factor
TF locus tag:	SE1746
Regulator family:	ArsR
Regulation mode:	repressor
Biological process:	Zinc resistance
Effector:	Zinc ion, (Zn2+)
Regulog:	CzrA - Staphylococcaceae
Statistics of regulated genes:
- Genes	2
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 6 sites [see more]

Member of regulog collections

By taxonomy - Staphylococcaceae
By trascription factor - CzrA
By TF family - ArsR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc resistance

Regulated operons
	Locus Tag	Name	Function
Position: -21 Score: 7.7 Sequence: AATATATGAACAAATATTCATATGTT Locus tag: SE1746 Name: czrA Funciton: zinc resistance repressor Locus tag: SE1747 Name: czrB Funciton: zinc resistance efflux pump
	SE1746	czrA	zinc resistance repressor
	SE1747	czrB	zinc resistance efflux pump

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD