Regulog FixK - Caulobacterales

Properties
Regulator type:	Transcription factor
Regulator family:	CRP
Regulation mode:	activator (repressor)
Biological process:	Oxidative stress response; Nitrogen fixation
Effector:	Oxygen
Phylum:	Proteobacteria/alpha
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 25 sites [see more]

Member of regulog collections

By taxonomy - Caulobacterales
By trascription factor - FnrN/FixK
By TF family - CRP
By effector - Oxygen
By pathway - Oxidative stress response
By pathway - Nitrogen fixation

Statistics of regulated genes
Genome	Genes	Operons
Caulobacter crescentus CB15	14	6
Caulobacter segnis ATCC 21756	23	7
Caulobacter sp. K31	23	5
Phenylobacterium zucineum HLK1	10	3

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes					Function

CRON 1.
ccoN	* Caulobacter crescentus CB15 Site: position = -73 score = 5.76391 sequence = GCTTTGATGCGTGTCAAAGC Gene: CC1401: Cytochrome c oxidase subunit CcoN (EC 1.9.3.1)	* Caulobacter segnis ATCC 21756 Site: position = -75 score = 5.71291 sequence = GCTTTGAGACAGATCAAAGC Gene: Cseg_1883: Cytochrome c oxidase subunit CcoN (EC 1.9.3.1)	* Caulobacter sp. K31 Site: position = -69 score = 4.53934 sequence = GCTTTGACCCAAGTCAATTT Gene: Caul_2437: Cytochrome c oxidase subunit CcoN (EC 1.9.3.1)	* Phenylobacterium zucineum HLK1 Site: position = -40 score = 5.9562 sequence = GCCTTGACCGATATCAAGGC Gene: PHZ_c2814: Cytochrome c oxidase subunit CcoN (EC 1.9.3.1)	Cytochrome c oxidase subunit CcoN (EC 1.9.3.1)
ccoO	Caulobacter crescentus CB15 Gene: CC1402: Cytochrome c oxidase subunit CcoO (EC 1.9.3.1)	Caulobacter segnis ATCC 21756 Gene: Cseg_1884: Cytochrome c oxidase subunit CcoO (EC 1.9.3.1)	Caulobacter sp. K31 Gene: Caul_2438: Cytochrome c oxidase subunit CcoO (EC 1.9.3.1)	Phenylobacterium zucineum HLK1 Gene: PHZ_c2813: Cytochrome c oxidase subunit CcoO (EC 1.9.3.1)	Cytochrome c oxidase subunit CcoO (EC 1.9.3.1)
ccoQ	Caulobacter crescentus CB15 Gene: CC1403: Cytochrome c oxidase subunit CcoQ (EC 1.9.3.1)	Caulobacter segnis ATCC 21756 Gene: Cseg_1885: Cytochrome c oxidase subunit CcoQ (EC 1.9.3.1)	Caulobacter sp. K31 Gene: Caul_2439: Cytochrome c oxidase subunit CcoQ (EC 1.9.3.1)	Phenylobacterium zucineum HLK1 Gene: PHZ_c2812: Cytochrome c oxidase subunit CcoQ (EC 1.9.3.1)	Cytochrome c oxidase subunit CcoQ (EC 1.9.3.1)
ccoP	Caulobacter crescentus CB15 Gene: CC1404: Cytochrome c oxidase subunit CcoP (EC 1.9.3.1)	Caulobacter segnis ATCC 21756 Gene: Cseg_1886: Cytochrome c oxidase subunit CcoP (EC 1.9.3.1)	Caulobacter sp. K31 Gene: Caul_2440: Cytochrome c oxidase subunit CcoP (EC 1.9.3.1)	Phenylobacterium zucineum HLK1 Gene: PHZ_c2811: Cytochrome c oxidase subunit CcoP (EC 1.9.3.1)	Cytochrome c oxidase subunit CcoP (EC 1.9.3.1)
ccoG	Caulobacter crescentus CB15 Gene: CC1405: Type cbb3 cytochrome oxidase biogenesis protein CcoG, involved in Cu oxidation	Caulobacter segnis ATCC 21756 Gene: Cseg_1887: Type cbb3 cytochrome oxidase biogenesis protein CcoG, involved in Cu oxidation	Caulobacter sp. K31 Gene: Caul_2441: Type cbb3 cytochrome oxidase biogenesis protein CcoG, involved in Cu oxidation	Phenylobacterium zucineum HLK1 Gene: PHZ_c2810: Type cbb3 cytochrome oxidase biogenesis protein CcoG, involved in Cu oxidation	Type cbb3 cytochrome oxidase biogenesis protein CcoG, involved in Cu oxidation
ccoH	Caulobacter crescentus CB15 Gene: CC1406: Type cbb3 cytochrome oxidase biogenesis protein CcoH	Caulobacter segnis ATCC 21756 Gene: Cseg_1888: Type cbb3 cytochrome oxidase biogenesis protein CcoH	Caulobacter sp. K31 Gene: Caul_2442: Type cbb3 cytochrome oxidase biogenesis protein CcoH	Phenylobacterium zucineum HLK1 Gene: PHZ_c2809: Type cbb3 cytochrome oxidase biogenesis protein CcoH	Type cbb3 cytochrome oxidase biogenesis protein CcoH
ccoI	Caulobacter crescentus CB15 Gene: CC1407: Type cbb3 cytochrome oxidase biogenesis protein CcoI; Copper-translocating P-type ATPase (EC 3.6.3.4)	Caulobacter segnis ATCC 21756 Gene: Cseg_1889: Type cbb3 cytochrome oxidase biogenesis protein CcoI; Copper-translocating P-type ATPase (EC 3.6.3.4)	Caulobacter sp. K31 Gene: Caul_2443: Type cbb3 cytochrome oxidase biogenesis protein CcoI; Copper-translocating P-type ATPase (EC 3.6.3.4)	Phenylobacterium zucineum HLK1 Gene: PHZ_c2808: Type cbb3 cytochrome oxidase biogenesis protein CcoI; Copper-translocating P-type ATPase (EC 3.6.3.4)	Type cbb3 cytochrome oxidase biogenesis protein CcoI; Copper-translocating P-type ATPase (EC 3.6.3.4)
ccoS	Caulobacter crescentus CB15 Gene: CC1408: Type cbb3 cytochrome oxidase biogenesis protein CcoS, involved in heme b insertion	Caulobacter segnis ATCC 21756 Gene: Cseg_1890: Type cbb3 cytochrome oxidase biogenesis protein CcoS, involved in heme b insertion	Caulobacter sp. K31 Gene: Caul_2444: Type cbb3 cytochrome oxidase biogenesis protein CcoS, involved in heme b insertion	Phenylobacterium zucineum HLK1 Gene: PHZ_c2807: Type cbb3 cytochrome oxidase biogenesis protein CcoS, involved in heme b insertion	Type cbb3 cytochrome oxidase biogenesis protein CcoS, involved in heme b insertion

CRON 2.
hemN	Caulobacter crescentus CB15 Gene: CC1411: Coproporphyrinogen III oxidase, oxygen-independent (EC 1.3.99.22)	* Caulobacter segnis ATCC 21756 Site: position = -65 score = 4.70535 sequence = GGATTGATCCAAATCACGGC Gene: Cseg_1891: Coproporphyrinogen III oxidase, oxygen-independent (EC 1.3.99.22)	* Caulobacter sp. K31 Site: position = -64 score = 5.20395 sequence = GACTTGACGCGCGTCAAGGT Gene: Caul_3872: Coproporphyrinogen III oxidase, oxygen-independent (EC 1.3.99.22)	* Phenylobacterium zucineum HLK1 Site: position = -52 score = 5.26772 sequence = TCCTTGATCTGAATCAGGGC Gene: PHZ_c2806: Coproporphyrinogen III oxidase, oxygen-independent (EC 1.3.99.22)	Coproporphyrinogen III oxidase, oxygen-independent (EC 1.3.99.22)

CRON 3.
cydA	* Caulobacter crescentus CB15 Site: position = -93 score = 6.17819 sequence = GCCTTGATCCGGATCAAGGA Gene: CC0762: Cytochrome d ubiquinol oxidase subunit I (EC 1.10.3.-)	* Caulobacter segnis ATCC 21756 Site: position = -92 score = 5.75795 sequence = TCCTTGATCACGATCAAGGC Gene: Cseg_3605: Cytochrome d ubiquinol oxidase subunit I (EC 1.10.3.-)	* Caulobacter sp. K31 Site: position = -92 score = 5.4648 sequence = TCCTTGACACCAATCAAAGC Gene: Caul_0634: Cytochrome d ubiquinol oxidase subunit I (EC 1.10.3.-)	Phenylobacterium zucineum HLK1	Cytochrome d ubiquinol oxidase subunit I (EC 1.10.3.-)
cydB	Caulobacter crescentus CB15 Gene: CC0763: Cytochrome d ubiquinol oxidase subunit II (EC 1.10.3.-)	Caulobacter segnis ATCC 21756 Gene: Cseg_3604: Cytochrome d ubiquinol oxidase subunit II (EC 1.10.3.-)	Caulobacter sp. K31 Gene: Caul_0635: Cytochrome d ubiquinol oxidase subunit II (EC 1.10.3.-)	Phenylobacterium zucineum HLK1	Cytochrome d ubiquinol oxidase subunit II (EC 1.10.3.-)
cydX	Caulobacter crescentus CB15	Caulobacter segnis ATCC 21756 Gene: Cseg_3603: CydX protein, presumably involved in maturation of CydAB complex	Caulobacter sp. K31 Gene: Caul_0636: CydX protein, presumably involved in maturation of CydAB complex	Phenylobacterium zucineum HLK1	CydX protein, presumably involved in maturation of CydAB complex

CRON 4.
ctaC	* Caulobacter crescentus CB15 Site: position = -45 score = 5.62979 sequence = GCCTTGATCGGGCTCAAATC Site: position = -12 score = 4.89948 sequence = GCCGTGAGGGATATGAAGGC Gene: CC3407: Cytochrome c oxidase polypeptide II (EC 1.9.3.1)	* Caulobacter segnis ATCC 21756 Site: position = -45 score = 4.1852 sequence = ACATTGATCATCGTCAAATC Site: position = -12 score = 4.89948 sequence = GCCGTGAGGGATATGAAGGC Gene: Cseg_0283: Cytochrome c oxidase polypeptide II (EC 1.9.3.1)	* Caulobacter sp. K31 Site: position = -75 score = 4.3412 sequence = ACGTTGATGTACGTCAAATC Site: position = -42 score = 4.89948 sequence = GCCGTGAGGGATATGAAGGC Gene: Caul_4506: Cytochrome c oxidase polypeptide II (EC 1.9.3.1)	Phenylobacterium zucineum HLK1 Gene: PHZ_c0542: Cytochrome c oxidase polypeptide II (EC 1.9.3.1)	Cytochrome c oxidase polypeptide II (EC 1.9.3.1)
ctaD	Caulobacter crescentus CB15 Gene: CC3406: Cytochrome c oxidase polypeptide I (EC 1.9.3.1)	Caulobacter segnis ATCC 21756 Gene: Cseg_0284: Cytochrome c oxidase polypeptide I (EC 1.9.3.1)	Caulobacter sp. K31 Gene: Caul_4505: Cytochrome c oxidase polypeptide I (EC 1.9.3.1)	2 Phenylobacterium zucineum HLK1 Gene: PHZ_c0543: Cytochrome c oxidase polypeptide I (EC 1.9.3.1) Gene: PHZ_c3176: Cytochrome c oxidase polypeptide I (EC 1.9.3.1)	Cytochrome c oxidase polypeptide I (EC 1.9.3.1)
ctaB	Caulobacter crescentus CB15 Gene: CC3405: Heme O synthase, protoheme IX farnesyltransferase (EC 2.5.1.-) COX10-CtaB	Caulobacter segnis ATCC 21756 Gene: Cseg_0285: Heme O synthase, protoheme IX farnesyltransferase (EC 2.5.1.-) COX10-CtaB	Caulobacter sp. K31 Gene: Caul_4504: Heme O synthase, protoheme IX farnesyltransferase (EC 2.5.1.-) COX10-CtaB	Phenylobacterium zucineum HLK1 Gene: PHZ_c0544: Heme O synthase, protoheme IX farnesyltransferase (EC 2.5.1.-) COX10-CtaB	Heme O synthase, protoheme IX farnesyltransferase (EC 2.5.1.-) COX10-CtaB
ctaX	Caulobacter crescentus CB15 Gene: CC3404: Hypothetical protein in cta-cyo gene cluster	Caulobacter segnis ATCC 21756 Gene: Cseg_0286: Hypothetical protein in cta-cyo gene cluster	Caulobacter sp. K31 Gene: Caul_4503: Hypothetical protein in cta-cyo gene cluster	Phenylobacterium zucineum HLK1	Hypothetical protein in cta-cyo gene cluster
ctaG	Caulobacter crescentus CB15 Gene: CC3403: Cytochrome oxidase biogenesis protein Cox11-CtaG, copper delivery to Cox1	Caulobacter segnis ATCC 21756 Gene: Cseg_0287: Cytochrome oxidase biogenesis protein Cox11-CtaG, copper delivery to Cox1	Caulobacter sp. K31 Gene: Caul_4502: Cytochrome oxidase biogenesis protein Cox11-CtaG, copper delivery to Cox1	Phenylobacterium zucineum HLK1 Gene: PHZ_c0545: Cytochrome oxidase biogenesis protein Cox11-CtaG, copper delivery to Cox1	Cytochrome oxidase biogenesis protein Cox11-CtaG, copper delivery to Cox1
ctaE	Caulobacter crescentus CB15 Gene: CC3402: Cytochrome c oxidase polypeptide III (EC 1.9.3.1)	Caulobacter segnis ATCC 21756 Gene: Cseg_0288: Cytochrome c oxidase polypeptide III (EC 1.9.3.1)	Caulobacter sp. K31 Gene: Caul_4501: Cytochrome c oxidase polypeptide III (EC 1.9.3.1)	Phenylobacterium zucineum HLK1 Gene: PHZ_c0546: Cytochrome c oxidase polypeptide III (EC 1.9.3.1)	Cytochrome c oxidase polypeptide III (EC 1.9.3.1)

CRON 5.
cydD	* Caulobacter crescentus CB15 Site: position = -50 score = 6.17819 sequence = TCCTTGATCCGGATCAAGGC Gene: CC0761: ATP-binding/permease protein CydD	* Caulobacter segnis ATCC 21756 Site: position = -50 score = 5.75795 sequence = GCCTTGATCGTGATCAAGGA Gene: Cseg_3606: ATP-binding/permease protein CydD	* Caulobacter sp. K31 Site: position = -77 score = 4.06203 sequence = CCCTATAGACGCGTCAAGGC Site: position = -51 score = 5.4648 sequence = GCTTTGATTGGTGTCAAGGA Gene: Caul_0633: ATP-binding/permease protein CydD	Phenylobacterium zucineum HLK1	ATP-binding/permease protein CydD
cydC	Caulobacter crescentus CB15 Gene: CC0760: ATP-binding/permease protein CydC	Caulobacter segnis ATCC 21756 Gene: Cseg_3607: ATP-binding/permease protein CydC	Caulobacter sp. K31 Gene: Caul_0632: ATP-binding/permease protein CydC	Phenylobacterium zucineum HLK1	ATP-binding/permease protein CydC
fixL	* Caulobacter crescentus CB15 Site: position = -37 score = 5.04113 sequence = GCCTTGACCTGGCTCAAACG Gene: CC0759: Two-component oxygen-sensor histidine kinase FixL	* Caulobacter segnis ATCC 21756 Site: position = -64 score = 4.88715 sequence = GCCTTGACCTGCCTCAAACG Gene: Cseg_3609: Two-component oxygen-sensor histidine kinase FixL	3 Caulobacter sp. K31 Gene: Caul_2969: Two-component oxygen-sensor histidine kinase FixL Gene: Caul_2345: Two-component oxygen-sensor histidine kinase FixL Gene: Caul_0631: Two-component oxygen-sensor histidine kinase FixL	2 Phenylobacterium zucineum HLK1 Gene: PHZ_c2803: Two-component oxygen-sensor histidine kinase FixL Gene: PHZ_p0187: Two-component oxygen-sensor histidine kinase FixL	Two-component oxygen-sensor histidine kinase FixL
fixJ	Caulobacter crescentus CB15 Gene: CC0758: Nitrogen fixation and oxygen response transcriptional regulator FixJ, LuxR family	Caulobacter segnis ATCC 21756 Gene: Cseg_3610: Nitrogen fixation and oxygen response transcriptional regulator FixJ, LuxR family	3 Caulobacter sp. K31 Gene: Caul_2968: Nitrogen fixation and oxygen response transcriptional regulator FixJ, LuxR family Gene: Caul_2344: Nitrogen fixation and oxygen response transcriptional regulator FixJ, LuxR family Gene: Caul_0630: Nitrogen fixation and oxygen response transcriptional regulator FixJ, LuxR family	2 Phenylobacterium zucineum HLK1 Gene: PHZ_c2804: Nitrogen fixation and oxygen response transcriptional regulator FixJ, LuxR family Gene: PHZ_p0188: Nitrogen fixation and oxygen response transcriptional regulator FixJ, LuxR family	Nitrogen fixation and oxygen response transcriptional regulator FixJ, LuxR family
fixK	* Caulobacter crescentus CB15 Site: position = -143 score = 5.1979 sequence = GCCTTGATCGGCGTCAAAAT Gene: CC0752: Nitrogen fixation and oxygen response transcriptional regulator FixK, Crp family	* Caulobacter segnis ATCC 21756 Site: position = -139 score = 5.23266 sequence = ACTTTGATCCCGGTCAAAAC Gene: Cseg_3612: Nitrogen fixation and oxygen response transcriptional regulator FixK, Crp family	3 Caulobacter sp. K31 Gene: Caul_0629: Nitrogen fixation and oxygen response transcriptional regulator FixK, Crp family Gene: Caul_2457: Nitrogen fixation and oxygen response transcriptional regulator FixK, Crp family Gene: Caul_2975: Nitrogen fixation and oxygen response transcriptional regulator FixK, Crp family	2 Phenylobacterium zucineum HLK1* Gene: PHZ_p0186: Nitrogen fixation and oxygen response transcriptional regulator FixK, Crp family Site: position = -136 score = 4.95669 sequence = GATGTGACGGCGATCAAAGC Gene: PHZ_c2798: Nitrogen fixation and oxygen response transcriptional regulator FixK, Crp family	Nitrogen fixation and oxygen response transcriptional regulator FixK, Crp family

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulog FixK - Caulobacterales

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --