Regulog FixK - Caulobacterales

Member of regulog collections
- By taxonomy - Caulobacterales
- By trascription factor - FnrN/FixK
- By TF family - CRP
- By effector - Oxygen
- By pathway - Oxidative stress response
- By pathway - Nitrogen fixation
Genome | Genes | Operons |
---|---|---|
Caulobacter crescentus CB15 | 14 | 6 |
Caulobacter segnis ATCC 21756 | 23 | 7 |
Caulobacter sp. K31 | 23 | 5 |
Phenylobacterium zucineum HLK1 | 10 | 3 |
Genes | Function | ||||
---|---|---|---|---|---|
CRON 1. | |||||
ccoN |
*
Caulobacter crescentus CB15 Site: position = -73 score = 5.76391 sequence = GCTTTGATGCGTGTCAAAGC Gene: CC1401: Cytochrome c oxidase subunit CcoN (EC 1.9.3.1) |
*
Caulobacter segnis ATCC 21756 Site: position = -75 score = 5.71291 sequence = GCTTTGAGACAGATCAAAGC Gene: Cseg_1883: Cytochrome c oxidase subunit CcoN (EC 1.9.3.1) |
*
Caulobacter sp. K31 Site: position = -69 score = 4.53934 sequence = GCTTTGACCCAAGTCAATTT Gene: Caul_2437: Cytochrome c oxidase subunit CcoN (EC 1.9.3.1) |
*
Phenylobacterium zucineum HLK1 Site: position = -40 score = 5.9562 sequence = GCCTTGACCGATATCAAGGC Gene: PHZ_c2814: Cytochrome c oxidase subunit CcoN (EC 1.9.3.1) |
Cytochrome c oxidase subunit CcoN (EC 1.9.3.1) |
ccoO |
Gene: CC1402: Cytochrome c oxidase subunit CcoO (EC 1.9.3.1) |
Gene: Cseg_1884: Cytochrome c oxidase subunit CcoO (EC 1.9.3.1) |
Gene: Caul_2438: Cytochrome c oxidase subunit CcoO (EC 1.9.3.1) |
Gene: PHZ_c2813: Cytochrome c oxidase subunit CcoO (EC 1.9.3.1) |
Cytochrome c oxidase subunit CcoO (EC 1.9.3.1) |
ccoQ |
Gene: CC1403: Cytochrome c oxidase subunit CcoQ (EC 1.9.3.1) |
Gene: Cseg_1885: Cytochrome c oxidase subunit CcoQ (EC 1.9.3.1) |
Gene: Caul_2439: Cytochrome c oxidase subunit CcoQ (EC 1.9.3.1) |
Gene: PHZ_c2812: Cytochrome c oxidase subunit CcoQ (EC 1.9.3.1) |
Cytochrome c oxidase subunit CcoQ (EC 1.9.3.1) |
ccoP |
Gene: CC1404: Cytochrome c oxidase subunit CcoP (EC 1.9.3.1) |
Gene: Cseg_1886: Cytochrome c oxidase subunit CcoP (EC 1.9.3.1) |
Gene: Caul_2440: Cytochrome c oxidase subunit CcoP (EC 1.9.3.1) |
Gene: PHZ_c2811: Cytochrome c oxidase subunit CcoP (EC 1.9.3.1) |
Cytochrome c oxidase subunit CcoP (EC 1.9.3.1) |
ccoG |
Gene: CC1405: Type cbb3 cytochrome oxidase biogenesis protein CcoG, involved in Cu oxidation |
Gene: Cseg_1887: Type cbb3 cytochrome oxidase biogenesis protein CcoG, involved in Cu oxidation |
Gene: Caul_2441: Type cbb3 cytochrome oxidase biogenesis protein CcoG, involved in Cu oxidation |
Gene: PHZ_c2810: Type cbb3 cytochrome oxidase biogenesis protein CcoG, involved in Cu oxidation |
Type cbb3 cytochrome oxidase biogenesis protein CcoG, involved in Cu oxidation |
ccoH |
Gene: CC1406: Type cbb3 cytochrome oxidase biogenesis protein CcoH |
Gene: Cseg_1888: Type cbb3 cytochrome oxidase biogenesis protein CcoH |
Gene: Caul_2442: Type cbb3 cytochrome oxidase biogenesis protein CcoH |
Gene: PHZ_c2809: Type cbb3 cytochrome oxidase biogenesis protein CcoH |
Type cbb3 cytochrome oxidase biogenesis protein CcoH |
ccoI |
Gene: CC1407: Type cbb3 cytochrome oxidase biogenesis protein CcoI; Copper-translocating P-type ATPase (EC 3.6.3.4) |
Gene: Cseg_1889: Type cbb3 cytochrome oxidase biogenesis protein CcoI; Copper-translocating P-type ATPase (EC 3.6.3.4) |
Gene: Caul_2443: Type cbb3 cytochrome oxidase biogenesis protein CcoI; Copper-translocating P-type ATPase (EC 3.6.3.4) |
Gene: PHZ_c2808: Type cbb3 cytochrome oxidase biogenesis protein CcoI; Copper-translocating P-type ATPase (EC 3.6.3.4) |
Type cbb3 cytochrome oxidase biogenesis protein CcoI; Copper-translocating P-type ATPase (EC 3.6.3.4) |
ccoS |
Gene: CC1408: Type cbb3 cytochrome oxidase biogenesis protein CcoS, involved in heme b insertion |
Gene: Cseg_1890: Type cbb3 cytochrome oxidase biogenesis protein CcoS, involved in heme b insertion |
Gene: Caul_2444: Type cbb3 cytochrome oxidase biogenesis protein CcoS, involved in heme b insertion |
Gene: PHZ_c2807: Type cbb3 cytochrome oxidase biogenesis protein CcoS, involved in heme b insertion |
Type cbb3 cytochrome oxidase biogenesis protein CcoS, involved in heme b insertion |
CRON 2. | |||||
hemN |
Gene: CC1411: Coproporphyrinogen III oxidase, oxygen-independent (EC 1.3.99.22) |
*
Caulobacter segnis ATCC 21756 Site: position = -65 score = 4.70535 sequence = GGATTGATCCAAATCACGGC Gene: Cseg_1891: Coproporphyrinogen III oxidase, oxygen-independent (EC 1.3.99.22) |
*
Caulobacter sp. K31 Site: position = -64 score = 5.20395 sequence = GACTTGACGCGCGTCAAGGT Gene: Caul_3872: Coproporphyrinogen III oxidase, oxygen-independent (EC 1.3.99.22) |
*
Phenylobacterium zucineum HLK1 Site: position = -52 score = 5.26772 sequence = TCCTTGATCTGAATCAGGGC Gene: PHZ_c2806: Coproporphyrinogen III oxidase, oxygen-independent (EC 1.3.99.22) |
Coproporphyrinogen III oxidase, oxygen-independent (EC 1.3.99.22) |
CRON 3. | |||||
cydA |
*
Caulobacter crescentus CB15 Site: position = -93 score = 6.17819 sequence = GCCTTGATCCGGATCAAGGA Gene: CC0762: Cytochrome d ubiquinol oxidase subunit I (EC 1.10.3.-) |
*
Caulobacter segnis ATCC 21756 Site: position = -92 score = 5.75795 sequence = TCCTTGATCACGATCAAGGC Gene: Cseg_3605: Cytochrome d ubiquinol oxidase subunit I (EC 1.10.3.-) |
*
Caulobacter sp. K31 Site: position = -92 score = 5.4648 sequence = TCCTTGACACCAATCAAAGC Gene: Caul_0634: Cytochrome d ubiquinol oxidase subunit I (EC 1.10.3.-) |
|
Cytochrome d ubiquinol oxidase subunit I (EC 1.10.3.-) |
cydB |
Gene: CC0763: Cytochrome d ubiquinol oxidase subunit II (EC 1.10.3.-) |
Gene: Cseg_3604: Cytochrome d ubiquinol oxidase subunit II (EC 1.10.3.-) |
Gene: Caul_0635: Cytochrome d ubiquinol oxidase subunit II (EC 1.10.3.-) |
|
Cytochrome d ubiquinol oxidase subunit II (EC 1.10.3.-) |
cydX |
|
Gene: Cseg_3603: CydX protein, presumably involved in maturation of CydAB complex |
Gene: Caul_0636: CydX protein, presumably involved in maturation of CydAB complex |
|
CydX protein, presumably involved in maturation of CydAB complex |
CRON 4. | |||||
ctaC |
*
Caulobacter crescentus CB15 Site: position = -45 score = 5.62979 sequence = GCCTTGATCGGGCTCAAATC Site: position = -12 score = 4.89948 sequence = GCCGTGAGGGATATGAAGGC Gene: CC3407: Cytochrome c oxidase polypeptide II (EC 1.9.3.1) |
*
Caulobacter segnis ATCC 21756 Site: position = -45 score = 4.1852 sequence = ACATTGATCATCGTCAAATC Site: position = -12 score = 4.89948 sequence = GCCGTGAGGGATATGAAGGC Gene: Cseg_0283: Cytochrome c oxidase polypeptide II (EC 1.9.3.1) |
*
Caulobacter sp. K31 Site: position = -75 score = 4.3412 sequence = ACGTTGATGTACGTCAAATC Site: position = -42 score = 4.89948 sequence = GCCGTGAGGGATATGAAGGC Gene: Caul_4506: Cytochrome c oxidase polypeptide II (EC 1.9.3.1) |
Gene: PHZ_c0542: Cytochrome c oxidase polypeptide II (EC 1.9.3.1) |
Cytochrome c oxidase polypeptide II (EC 1.9.3.1) |
ctaD |
Gene: CC3406: Cytochrome c oxidase polypeptide I (EC 1.9.3.1) |
Gene: Cseg_0284: Cytochrome c oxidase polypeptide I (EC 1.9.3.1) |
Gene: Caul_4505: Cytochrome c oxidase polypeptide I (EC 1.9.3.1) |
2
Phenylobacterium zucineum HLK1 Gene: PHZ_c0543: Cytochrome c oxidase polypeptide I (EC 1.9.3.1) Gene: PHZ_c3176: Cytochrome c oxidase polypeptide I (EC 1.9.3.1) |
Cytochrome c oxidase polypeptide I (EC 1.9.3.1) |
ctaB |
Gene: CC3405: Heme O synthase, protoheme IX farnesyltransferase (EC 2.5.1.-) COX10-CtaB |
Gene: Cseg_0285: Heme O synthase, protoheme IX farnesyltransferase (EC 2.5.1.-) COX10-CtaB |
Gene: Caul_4504: Heme O synthase, protoheme IX farnesyltransferase (EC 2.5.1.-) COX10-CtaB |
Gene: PHZ_c0544: Heme O synthase, protoheme IX farnesyltransferase (EC 2.5.1.-) COX10-CtaB |
Heme O synthase, protoheme IX farnesyltransferase (EC 2.5.1.-) COX10-CtaB |
ctaX |
Gene: CC3404: Hypothetical protein in cta-cyo gene cluster |
Gene: Cseg_0286: Hypothetical protein in cta-cyo gene cluster |
Gene: Caul_4503: Hypothetical protein in cta-cyo gene cluster |
|
Hypothetical protein in cta-cyo gene cluster |
ctaG |
Gene: CC3403: Cytochrome oxidase biogenesis protein Cox11-CtaG, copper delivery to Cox1 |
Gene: Cseg_0287: Cytochrome oxidase biogenesis protein Cox11-CtaG, copper delivery to Cox1 |
Gene: Caul_4502: Cytochrome oxidase biogenesis protein Cox11-CtaG, copper delivery to Cox1 |
Gene: PHZ_c0545: Cytochrome oxidase biogenesis protein Cox11-CtaG, copper delivery to Cox1 |
Cytochrome oxidase biogenesis protein Cox11-CtaG, copper delivery to Cox1 |
ctaE |
Gene: CC3402: Cytochrome c oxidase polypeptide III (EC 1.9.3.1) |
Gene: Cseg_0288: Cytochrome c oxidase polypeptide III (EC 1.9.3.1) |
Gene: Caul_4501: Cytochrome c oxidase polypeptide III (EC 1.9.3.1) |
Gene: PHZ_c0546: Cytochrome c oxidase polypeptide III (EC 1.9.3.1) |
Cytochrome c oxidase polypeptide III (EC 1.9.3.1) |
CRON 5. | |||||
cydD |
*
Caulobacter crescentus CB15 Site: position = -50 score = 6.17819 sequence = TCCTTGATCCGGATCAAGGC Gene: CC0761: ATP-binding/permease protein CydD |
*
Caulobacter segnis ATCC 21756 Site: position = -50 score = 5.75795 sequence = GCCTTGATCGTGATCAAGGA Gene: Cseg_3606: ATP-binding/permease protein CydD |
*
Caulobacter sp. K31 Site: position = -77 score = 4.06203 sequence = CCCTATAGACGCGTCAAGGC Site: position = -51 score = 5.4648 sequence = GCTTTGATTGGTGTCAAGGA Gene: Caul_0633: ATP-binding/permease protein CydD |
|
ATP-binding/permease protein CydD |
cydC |
Gene: CC0760: ATP-binding/permease protein CydC |
Gene: Cseg_3607: ATP-binding/permease protein CydC |
Gene: Caul_0632: ATP-binding/permease protein CydC |
|
ATP-binding/permease protein CydC |
fixL |
*
Caulobacter crescentus CB15 Site: position = -37 score = 5.04113 sequence = GCCTTGACCTGGCTCAAACG Gene: CC0759: Two-component oxygen-sensor histidine kinase FixL |
*
Caulobacter segnis ATCC 21756 Site: position = -64 score = 4.88715 sequence = GCCTTGACCTGCCTCAAACG Gene: Cseg_3609: Two-component oxygen-sensor histidine kinase FixL |
3
Caulobacter sp. K31 Gene: Caul_2969: Two-component oxygen-sensor histidine kinase FixL Gene: Caul_2345: Two-component oxygen-sensor histidine kinase FixL Gene: Caul_0631: Two-component oxygen-sensor histidine kinase FixL |
2
Phenylobacterium zucineum HLK1 Gene: PHZ_c2803: Two-component oxygen-sensor histidine kinase FixL Gene: PHZ_p0187: Two-component oxygen-sensor histidine kinase FixL |
Two-component oxygen-sensor histidine kinase FixL |
fixJ |
Gene: CC0758: Nitrogen fixation and oxygen response transcriptional regulator FixJ, LuxR family |
Gene: Cseg_3610: Nitrogen fixation and oxygen response transcriptional regulator FixJ, LuxR family |
3
Caulobacter sp. K31 Gene: Caul_2968: Nitrogen fixation and oxygen response transcriptional regulator FixJ, LuxR family Gene: Caul_2344: Nitrogen fixation and oxygen response transcriptional regulator FixJ, LuxR family Gene: Caul_0630: Nitrogen fixation and oxygen response transcriptional regulator FixJ, LuxR family |
2
Phenylobacterium zucineum HLK1 Gene: PHZ_c2804: Nitrogen fixation and oxygen response transcriptional regulator FixJ, LuxR family Gene: PHZ_p0188: Nitrogen fixation and oxygen response transcriptional regulator FixJ, LuxR family |
Nitrogen fixation and oxygen response transcriptional regulator FixJ, LuxR family |
fixK |
*
Caulobacter crescentus CB15 Site: position = -143 score = 5.1979 sequence = GCCTTGATCGGCGTCAAAAT Gene: CC0752: Nitrogen fixation and oxygen response transcriptional regulator FixK, Crp family |
*
Caulobacter segnis ATCC 21756 Site: position = -139 score = 5.23266 sequence = ACTTTGATCCCGGTCAAAAC Gene: Cseg_3612: Nitrogen fixation and oxygen response transcriptional regulator FixK, Crp family |
3
Caulobacter sp. K31 Gene: Caul_0629: Nitrogen fixation and oxygen response transcriptional regulator FixK, Crp family Gene: Caul_2457: Nitrogen fixation and oxygen response transcriptional regulator FixK, Crp family Gene: Caul_2975: Nitrogen fixation and oxygen response transcriptional regulator FixK, Crp family |
*2
Phenylobacterium zucineum HLK1 Gene: PHZ_p0186: Nitrogen fixation and oxygen response transcriptional regulator FixK, Crp family Site: position = -136 score = 4.95669 sequence = GATGTGACGGCGATCAAAGC Gene: PHZ_c2798: Nitrogen fixation and oxygen response transcriptional regulator FixK, Crp family |
Nitrogen fixation and oxygen response transcriptional regulator FixK, Crp family |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
![]() |
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
![]() |
Regulatory Sites | [ FASTA format ] | DOWNLOAD |