Regulon of FixK in Caulobacter sp. K31

Properties
Regulator type:	Transcription factor
TF locus tag:	Caul_0629, Caul_2457, Caul_2975
Regulator family:	CRP
Regulation mode:	activator (repressor)
Biological process:	Oxidative stress response; Nitrogen fixation
Effector:	Oxygen
Regulog:	FixK - Caulobacterales
Statistics of regulated genes:
- Genes	23
- Operons	5
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 25 sites [see more]

Member of regulog collections

By taxonomy - Caulobacterales
By trascription factor - FnrN/FixK
By TF family - CRP
By effector - Oxygen
By pathway - Oxidative stress response
By pathway - Nitrogen fixation

Regulated operons
	Locus Tag	Name	Function
Position: -75 Score: 4.3 Sequence: ACGTTGATGTACGTCAAATC Position: -42 Score: 4.9 Sequence: GCCGTGAGGGATATGAAGGC Locus tag: Caul_4506 Name: ctaC Funciton: Cytochrome c oxidase polypeptide II (EC 1.9.3.1) Locus tag: Caul_4505 Name: ctaD Funciton: Cytochrome c oxidase polypeptide I (EC 1.9.3.1) Locus tag: Caul_4504 Name: ctaB Funciton: Heme O synthase, protoheme IX farnesyltransferase (EC 2.5.1.-) COX10-CtaB Locus tag: Caul_4503 Name: ctaX Funciton: Hypothetical protein in cta-cyo gene cluster Locus tag: Caul_4502 Name: ctaG Funciton: Cytochrome oxidase biogenesis protein Cox11-CtaG, copper delivery to Cox1 Locus tag: Caul_4501 Name: ctaE Funciton: Cytochrome c oxidase polypeptide III (EC 1.9.3.1)
	Caul_4506	ctaC	Cytochrome c oxidase polypeptide II (EC 1.9.3.1)
	Caul_4505	ctaD	Cytochrome c oxidase polypeptide I (EC 1.9.3.1)
	Caul_4504	ctaB	Heme O synthase, protoheme IX farnesyltransferase (EC 2.5.1.-) COX10-CtaB
	Caul_4503	ctaX	Hypothetical protein in cta-cyo gene cluster
	Caul_4502	ctaG	Cytochrome oxidase biogenesis protein Cox11-CtaG, copper delivery to Cox1
	Caul_4501	ctaE	Cytochrome c oxidase polypeptide III (EC 1.9.3.1)
Position: -92 Score: 5.5 Sequence: TCCTTGACACCAATCAAAGC Locus tag: Caul_0634 Name: cydA Funciton: Cytochrome d ubiquinol oxidase subunit I (EC 1.10.3.-) Locus tag: Caul_0635 Name: cydB Funciton: Cytochrome d ubiquinol oxidase subunit II (EC 1.10.3.-) Locus tag: Caul_0636 Name: cydX Funciton: CydX protein, presumably involved in maturation of CydAB complex
	Caul_0634	cydA	Cytochrome d ubiquinol oxidase subunit I (EC 1.10.3.-)
	Caul_0635	cydB	Cytochrome d ubiquinol oxidase subunit II (EC 1.10.3.-)
	Caul_0636	cydX	CydX protein, presumably involved in maturation of CydAB complex
Position: -64 Score: 5.2 Sequence: GACTTGACGCGCGTCAAGGT Locus tag: Caul_3872 Name: hemN Funciton: Coproporphyrinogen III oxidase, oxygen-independent (EC 1.3.99.22)
	Caul_3872	hemN	Coproporphyrinogen III oxidase, oxygen-independent (EC 1.3.99.22)
Position: -69 Score: 4.5 Sequence: GCTTTGACCCAAGTCAATTT Locus tag: Caul_2437 Name: ccoN Funciton: Cytochrome c oxidase subunit CcoN (EC 1.9.3.1) Locus tag: Caul_2438 Name: ccoO Funciton: Cytochrome c oxidase subunit CcoO (EC 1.9.3.1) Locus tag: Caul_2439 Name: ccoQ Funciton: Cytochrome c oxidase subunit CcoQ (EC 1.9.3.1) Locus tag: Caul_2440 Name: ccoP Funciton: Cytochrome c oxidase subunit CcoP (EC 1.9.3.1) Locus tag: Caul_2441 Name: ccoG Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoG, involved in Cu oxidation Locus tag: Caul_2442 Name: ccoH Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoH Locus tag: Caul_2443 Name: ccoI Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoI; Copper-translocating P-type ATPase (EC 3.6.3.4) Locus tag: Caul_2444 Name: ccoS Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoS, involved in heme b insertion
	Caul_2437	ccoN	Cytochrome c oxidase subunit CcoN (EC 1.9.3.1)
	Caul_2438	ccoO	Cytochrome c oxidase subunit CcoO (EC 1.9.3.1)
	Caul_2439	ccoQ	Cytochrome c oxidase subunit CcoQ (EC 1.9.3.1)
	Caul_2440	ccoP	Cytochrome c oxidase subunit CcoP (EC 1.9.3.1)
	Caul_2441	ccoG	Type cbb3 cytochrome oxidase biogenesis protein CcoG, involved in Cu oxidation
	Caul_2442	ccoH	Type cbb3 cytochrome oxidase biogenesis protein CcoH
	Caul_2443	ccoI	Type cbb3 cytochrome oxidase biogenesis protein CcoI; Copper-translocating P-type ATPase (EC 3.6.3.4)
	Caul_2444	ccoS	Type cbb3 cytochrome oxidase biogenesis protein CcoS, involved in heme b insertion
Position: -77 Score: 4.1 Sequence: CCCTATAGACGCGTCAAGGC Position: -51 Score: 5.5 Sequence: GCTTTGATTGGTGTCAAGGA Locus tag: Caul_0633 Name: cydD Funciton: ATP-binding/permease protein CydD Locus tag: Caul_0632 Name: cydC Funciton: ATP-binding/permease protein CydC Locus tag: Caul_0631 Name: fixL Funciton: Two-component oxygen-sensor histidine kinase FixL Locus tag: Caul_0630 Name: fixJ Funciton: Nitrogen fixation and oxygen response transcriptional regulator FixJ, LuxR family Locus tag: Caul_0629 Name: fixK Funciton: Nitrogen fixation and oxygen response transcriptional regulator FixK, Crp family
	Caul_0633	cydD	ATP-binding/permease protein CydD
	Caul_0632	cydC	ATP-binding/permease protein CydC
	Caul_0631	fixL	Two-component oxygen-sensor histidine kinase FixL
	Caul_0630	fixJ	Nitrogen fixation and oxygen response transcriptional regulator FixJ, LuxR family
	Caul_0629	fixK	Nitrogen fixation and oxygen response transcriptional regulator FixK, Crp family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulon of FixK in Caulobacter sp. K31

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --