Regulon of FixK in Phenylobacterium zucineum HLK1

Properties
Regulator type:	Transcription factor
TF locus tag:	PHZ_p0186, PHZ_c2798
Regulator family:	CRP
Regulation mode:	activator (repressor)
Biological process:	Oxidative stress response; Nitrogen fixation
Effector:	Oxygen
Regulog:	FixK - Caulobacterales
Statistics of regulated genes:
- Genes	10
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 25 sites [see more]

Member of regulog collections

By taxonomy - Caulobacterales
By trascription factor - FnrN/FixK
By TF family - CRP
By effector - Oxygen
By pathway - Oxidative stress response
By pathway - Nitrogen fixation

Regulated operons
	Locus Tag	Name	Function
Position: -52 Score: 5.3 Sequence: TCCTTGATCTGAATCAGGGC Locus tag: PHZ_c2806 Name: hemN Funciton: Coproporphyrinogen III oxidase, oxygen-independent (EC 1.3.99.22)
	PHZ_c2806	hemN	Coproporphyrinogen III oxidase, oxygen-independent (EC 1.3.99.22)
Position: -40 Score: 6 Sequence: GCCTTGACCGATATCAAGGC Locus tag: PHZ_c2814 Name: ccoN Funciton: Cytochrome c oxidase subunit CcoN (EC 1.9.3.1) Locus tag: PHZ_c2813 Name: ccoO Funciton: Cytochrome c oxidase subunit CcoO (EC 1.9.3.1) Locus tag: PHZ_c2812 Name: ccoQ Funciton: Cytochrome c oxidase subunit CcoQ (EC 1.9.3.1) Locus tag: PHZ_c2811 Name: ccoP Funciton: Cytochrome c oxidase subunit CcoP (EC 1.9.3.1) Locus tag: PHZ_c2810 Name: ccoG Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoG, involved in Cu oxidation Locus tag: PHZ_c2809 Name: ccoH Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoH Locus tag: PHZ_c2808 Name: ccoI Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoI; Copper-translocating P-type ATPase (EC 3.6.3.4) Locus tag: PHZ_c2807 Name: ccoS Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoS, involved in heme b insertion
	PHZ_c2814	ccoN	Cytochrome c oxidase subunit CcoN (EC 1.9.3.1)
	PHZ_c2813	ccoO	Cytochrome c oxidase subunit CcoO (EC 1.9.3.1)
	PHZ_c2812	ccoQ	Cytochrome c oxidase subunit CcoQ (EC 1.9.3.1)
	PHZ_c2811	ccoP	Cytochrome c oxidase subunit CcoP (EC 1.9.3.1)
	PHZ_c2810	ccoG	Type cbb3 cytochrome oxidase biogenesis protein CcoG, involved in Cu oxidation
	PHZ_c2809	ccoH	Type cbb3 cytochrome oxidase biogenesis protein CcoH
	PHZ_c2808	ccoI	Type cbb3 cytochrome oxidase biogenesis protein CcoI; Copper-translocating P-type ATPase (EC 3.6.3.4)
	PHZ_c2807	ccoS	Type cbb3 cytochrome oxidase biogenesis protein CcoS, involved in heme b insertion
Position: -136 Score: 5 Sequence: GATGTGACGGCGATCAAAGC Locus tag: PHZ_c2798 Name: fixK Funciton: Nitrogen fixation and oxygen response transcriptional regulator FixK, Crp family
	PHZ_c2798	fixK	Nitrogen fixation and oxygen response transcriptional regulator FixK, Crp family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD