Regulog TtrR - Enterobacteriales
| Regulator type: | Transcription factor |
| Regulator family: | LuxR |
| Regulation mode: | activator |
| Biological process: | Tetrathionate reduction |
| Effector: | Tetrathionate |
| Phylum: | Proteobacteria/gamma |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Enterobacteriales
- By trascription factor - TtrR
- By TF family - LuxR
- By effector - Tetrathionate
- By pathway - Tetrathionate reduction
| Genome | Genes | Operons |
|---|---|---|
| Citrobacter koseri ATCC BAA-895 | ||
| Edwardsiella tarda EIB202 | 5 | 2 |
| Enterobacter sp. 638 | ||
| Erwinia amylovora ATCC 49946 | ||
| Erwinia carotovora subsp. atroseptica SCRI1043 | ||
| Escherichia coli str. K-12 substr. MG1655 | ||
| Klebsiella pneumoniae subsp. pneumoniae MGH 78578 | ||
| Photorhabdus luminescens subsp. laumondii TTO1 | ||
| Proteus mirabilis HI4320 | 5 | 2 |
| Salmonella typhimurium LT2 | 5 | 2 |
| Serratia proteamaculans 568 | 5 | 2 |
| Yersinia pestis KIM |
| Genes | Function | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||||||
| ttrB |
|
*
Edwardsiella tarda EIB202 Site: position = -131 score = 6.65743 sequence = GCTATTGTGGTTTTCCACAATAGG Gene: ETAE_1647: Tetrathionate reductase, subunit B |
|
|
|
|
|
|
*
Proteus mirabilis HI4320 Site: position = -121 score = 6.52334 sequence = GAGTATGTGGTAAACCACAATAGG Gene: PMI1683: Tetrathionate reductase, subunit B |
*
Salmonella typhimurium LT2 Site: position = -118 score = 6.50818 sequence = GGGTATGTGGTTAACCACAATAGA Gene: STM1385: Tetrathionate reductase, subunit B |
*
Serratia proteamaculans 568 Site: position = -92 score = 6.49378 sequence = GGGAATGTGGTAAACCACAATATT Gene: Spro_1067: Tetrathionate reductase, subunit B |
|
Tetrathionate reductase, subunit B |
| ttrC |
|
Gene: ETAE_1648: Tetrathionate reductase subunit C |
|
|
|
|
|
|
Gene: PMI1682: Tetrathionate reductase subunit C |
Gene: STM1384: Tetrathionate reductase subunit C |
Gene: Spro_1068: Tetrathionate reductase subunit C |
|
Tetrathionate reductase subunit C |
| ttrA |
|
Gene: ETAE_1649: Tetrathionate reductase subunit A |
|
|
|
|
|
|
Gene: PMI1681: Tetrathionate reductase subunit A |
Gene: STM1383: Tetrathionate reductase subunit A |
Gene: Spro_1069: Tetrathionate reductase subunit A |
|
Tetrathionate reductase subunit A |
| CRON 2. | |||||||||||||
| ttrS |
|
*
Edwardsiella tarda EIB202 Site: position = -85 score = 6.65743 sequence = CCTATTGTGGAAAACCACAATAGC Gene: ETAE_1646: Tetrathionate reduction sensor protein TtrS |
|
|
|
|
|
|
*
Proteus mirabilis HI4320 Site: position = -66 score = 6.52334 sequence = CCTATTGTGGTTTACCACATACTC Gene: PMI1684: Tetrathionate reduction sensor protein TtrS |
*
Salmonella typhimurium LT2 Site: position = -69 score = 6.50818 sequence = TCTATTGTGGTTAACCACATACCC Gene: STM1386: Tetrathionate reduction sensor protein TtrS |
*
Serratia proteamaculans 568 Site: position = -85 score = 6.49378 sequence = AATATTGTGGTTTACCACATTCCC Gene: Spro_1066: Tetrathionate reduction sensor protein TtrS |
|
Tetrathionate reduction sensor protein TtrS |
| ttrR |
|
Gene: ETAE_1645: Tetrathionate reduction response regulator protein TtrR, LuxR family |
|
|
|
|
|
|
Gene: PMI1685: Tetrathionate reduction response regulator protein TtrR, LuxR family |
Gene: STM1387: Tetrathionate reduction response regulator protein TtrR, LuxR family |
Gene: Spro_1065: Tetrathionate reduction response regulator protein TtrR, LuxR family |
|
Tetrathionate reduction response regulator protein TtrR, LuxR family |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |