Regulon of TtrR in Edwardsiella tarda EIB202

Properties
Regulator type:	Transcription factor
TF locus tag:	ETAE_1645
Regulator family:	LuxR
Regulation mode:	activator
Biological process:	Tetrathionate reduction
Effector:	Tetrathionate
Regulog:	TtrR - Enterobacteriales
Statistics of regulated genes:
- Genes	5
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 8 sites [see more]

Member of regulog collections

By taxonomy - Enterobacteriales
By trascription factor - TtrR
By TF family - LuxR
By effector - Tetrathionate
By pathway - Tetrathionate reduction

Regulated operons
	Locus Tag	Name	Function
Position: -85 Score: 6.7 Sequence: CCTATTGTGGAAAACCACAATAGC Locus tag: ETAE_1646 Name: ttrS Funciton: Tetrathionate reduction sensor protein TtrS Locus tag: ETAE_1645 Name: ttrR Funciton: Tetrathionate reduction response regulator protein TtrR, LuxR family
	ETAE_1646	ttrS	Tetrathionate reduction sensor protein TtrS
	ETAE_1645	ttrR	Tetrathionate reduction response regulator protein TtrR, LuxR family
Position: -131 Score: 6.7 Sequence: GCTATTGTGGTTTTCCACAATAGG Locus tag: ETAE_1647 Name: ttrB Funciton: Tetrathionate reductase, subunit B Locus tag: ETAE_1648 Name: ttrC Funciton: Tetrathionate reductase subunit C Locus tag: ETAE_1649 Name: ttrA Funciton: Tetrathionate reductase subunit A
	ETAE_1647	ttrB	Tetrathionate reductase, subunit B
	ETAE_1648	ttrC	Tetrathionate reductase subunit C
	ETAE_1649	ttrA	Tetrathionate reductase subunit A

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD