Regulog TtrR - Vibrionales
| Regulator type: | Transcription factor |
| Regulator family: | LuxR |
| Regulation mode: | |
| Biological process: | Tetrathionate reduction |
| Effector: | Tetrathionate |
| Phylum: | Proteobacteria/gamma |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Vibrionales
- By trascription factor - TtrR
- By TF family - LuxR
- By effector - Tetrathionate
- By pathway - Tetrathionate reduction
| Genome | Genes | Operons |
|---|---|---|
| Photobacterium profundum SS9 | 3 | 2 |
| Vibrio angustum S14 | ||
| Vibrio cholerae O1 biovar eltor str. N16961 | ||
| Vibrio fischeri ES114 | ||
| Vibrio harveyi ATCC BAA-1116 | ||
| Vibrio parahaemolyticus RIMD 2210633 | 3 | 2 |
| Vibrio salmonicida LFI1238 | ||
| Vibrio shilonii AK1 | 5 | 2 |
| Vibrio splendidus LGP32 | ||
| Vibrio vulnificus CMCP6 |
| Genes | Function | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||||
| ttrS |
*
Photobacterium profundum SS9 Site: position = -175 score = 5.98919 sequence = CCTATTGTGGTTTTCCACATACCC Gene: PBPRB0007: Tetrathionate reduction sensor protein TtrS |
|
|
|
|
*
Vibrio parahaemolyticus RIMD 2210633 Site: position = -215 score = 6.40982 sequence = GATATAGTGGATTTCCACATACCC Gene: VP2010: Tetrathionate reduction sensor protein TtrS |
|
*
Vibrio shilonii AK1 Site: position = -110 score = 6.21256 sequence = GATATAGTGGATTTCCACATACCA Gene: VSAK1_06450: Tetrathionate reduction sensor protein TtrS |
|
|
Tetrathionate reduction sensor protein TtrS |
| ttrR |
Gene: PBPRB0008: Tetrathionate reduction response regulator protein TtrR, LuxR family |
|
|
|
|
Gene: VP2009: Tetrathionate reduction response regulator protein TtrR, LuxR family |
|
Gene: VSAK1_06445: Tetrathionate reduction response regulator protein TtrR, LuxR family |
|
|
Tetrathionate reduction response regulator protein TtrR, LuxR family |
| CRON 2. | |||||||||||
| ttrC |
*
Photobacterium profundum SS9 Site: position = -106 score = 5.98919 sequence = GGGTATGTGGAAAACCACAATAGG Gene: PBPRB0006: Tetrathionate reductase subunit B |
|
|
|
|
*
Vibrio parahaemolyticus RIMD 2210633 Site: position = -89 score = 6.40982 sequence = GGGTATGTGGAAATCCACTATATC Gene: VP2011: Tetrathionate reductase subunit B |
|
*
Vibrio shilonii AK1 Site: position = -84 score = 6.21256 sequence = TGGTATGTGGAAATCCACTATATC Gene: VSAK1_06455: Tetrathionate reductase subunit B |
|
|
Tetrathionate reductase subunit B |
| ttrC |
Gene: PBPRB0004: Tetrathionate reductase subunit C |
|
|
|
|
Gene: VP2013: Tetrathionate reductase subunit C |
|
Gene: VSAK1_06460: Tetrathionate reductase subunit C |
|
|
Tetrathionate reductase subunit C |
| ttrA |
Gene: PBPRB0003: Tetrathionate reductase subunit A |
|
|
|
|
Gene: VP2014: Tetrathionate reductase subunit A |
|
Gene: VSAK1_06465: Tetrathionate reductase subunit A |
|
|
Tetrathionate reductase subunit A |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |