Statistics of regulated genes

Genome	Genes	Operons
Photobacterium profundum SS9	3	2
Vibrio angustum S14
Vibrio cholerae O1 biovar eltor str. N16961
Vibrio fischeri ES114
Vibrio harveyi ATCC BAA-1116
Vibrio parahaemolyticus RIMD 2210633	3	2
Vibrio salmonicida LFI1238
Vibrio shilonii AK1	5	2
Vibrio splendidus LGP32
Vibrio vulnificus CMCP6

Clusters of co-Regulated Orthologous operoNs (CRONs)

Genes											Function
CRON 1.
ttrS	* Photobacterium profundum SS9 Site: position = -175 score = 5.98919 sequence = CCTATTGTGGTTTTCCACATACCC Gene: PBPRB0007: Tetrathionate reduction sensor protein TtrS	Vibrio angustum S14	Vibrio cholerae O1 biovar eltor str. N16961	Vibrio fischeri ES114	Vibrio harveyi ATCC BAA-1116	* Vibrio parahaemolyticus RIMD 2210633 Site: position = -215 score = 6.40982 sequence = GATATAGTGGATTTCCACATACCC Gene: VP2010: Tetrathionate reduction sensor protein TtrS	Vibrio salmonicida LFI1238	* Vibrio shilonii AK1 Site: position = -110 score = 6.21256 sequence = GATATAGTGGATTTCCACATACCA Gene: VSAK1_06450: Tetrathionate reduction sensor protein TtrS	Vibrio splendidus LGP32	Vibrio vulnificus CMCP6	Tetrathionate reduction sensor protein TtrS
ttrR	Photobacterium profundum SS9 Gene: PBPRB0008: Tetrathionate reduction response regulator protein TtrR, LuxR family	Vibrio angustum S14	Vibrio cholerae O1 biovar eltor str. N16961	Vibrio fischeri ES114	Vibrio harveyi ATCC BAA-1116	Vibrio parahaemolyticus RIMD 2210633 Gene: VP2009: Tetrathionate reduction response regulator protein TtrR, LuxR family	Vibrio salmonicida LFI1238	Vibrio shilonii AK1 Gene: VSAK1_06445: Tetrathionate reduction response regulator protein TtrR, LuxR family	Vibrio splendidus LGP32	Vibrio vulnificus CMCP6	Tetrathionate reduction response regulator protein TtrR, LuxR family
CRON 2.
ttrC	* Photobacterium profundum SS9 Site: position = -106 score = 5.98919 sequence = GGGTATGTGGAAAACCACAATAGG Gene: PBPRB0006: Tetrathionate reductase subunit B	Vibrio angustum S14	Vibrio cholerae O1 biovar eltor str. N16961	Vibrio fischeri ES114	Vibrio harveyi ATCC BAA-1116	* Vibrio parahaemolyticus RIMD 2210633 Site: position = -89 score = 6.40982 sequence = GGGTATGTGGAAATCCACTATATC Gene: VP2011: Tetrathionate reductase subunit B	Vibrio salmonicida LFI1238	* Vibrio shilonii AK1 Site: position = -84 score = 6.21256 sequence = TGGTATGTGGAAATCCACTATATC Gene: VSAK1_06455: Tetrathionate reductase subunit B	Vibrio splendidus LGP32	Vibrio vulnificus CMCP6	Tetrathionate reductase subunit B
ttrC	Photobacterium profundum SS9 Gene: PBPRB0004: Tetrathionate reductase subunit C	Vibrio angustum S14	Vibrio cholerae O1 biovar eltor str. N16961	Vibrio fischeri ES114	Vibrio harveyi ATCC BAA-1116	Vibrio parahaemolyticus RIMD 2210633 Gene: VP2013: Tetrathionate reductase subunit C	Vibrio salmonicida LFI1238	Vibrio shilonii AK1 Gene: VSAK1_06460: Tetrathionate reductase subunit C	Vibrio splendidus LGP32	Vibrio vulnificus CMCP6	Tetrathionate reductase subunit C
ttrA	Photobacterium profundum SS9 Gene: PBPRB0003: Tetrathionate reductase subunit A	Vibrio angustum S14	Vibrio cholerae O1 biovar eltor str. N16961	Vibrio fischeri ES114	Vibrio harveyi ATCC BAA-1116	Vibrio parahaemolyticus RIMD 2210633 Gene: VP2014: Tetrathionate reductase subunit A	Vibrio salmonicida LFI1238	Vibrio shilonii AK1 Gene: VSAK1_06465: Tetrathionate reductase subunit A	Vibrio splendidus LGP32	Vibrio vulnificus CMCP6	Tetrathionate reductase subunit A

Export

	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD