Regulon of TtrR in Vibrio shilonii AK1

Properties
Regulator type:	Transcription factor
TF locus tag:	VSAK1_06445
Regulator family:	LuxR
Regulation mode:
Biological process:	Tetrathionate reduction
Effector:	Tetrathionate
Regulog:	TtrR - Vibrionales
Statistics of regulated genes:
- Genes	5
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 6 sites [see more]

Member of regulog collections

By taxonomy - Vibrionales
By trascription factor - TtrR
By TF family - LuxR
By effector - Tetrathionate
By pathway - Tetrathionate reduction

Regulated operons
	Locus Tag	Name	Function
Position: -84 Score: 6.2 Sequence: TGGTATGTGGAAATCCACTATATC Locus tag: VSAK1_06455 Name: ttrC Funciton: Tetrathionate reductase subunit B Locus tag: VSAK1_06460 Name: ttrC Funciton: Tetrathionate reductase subunit C Locus tag: VSAK1_06465 Name: ttrA Funciton: Tetrathionate reductase subunit A
	VSAK1_06455	ttrC	Tetrathionate reductase subunit B
	VSAK1_06460	ttrC	Tetrathionate reductase subunit C
	VSAK1_06465	ttrA	Tetrathionate reductase subunit A
Position: -110 Score: 6.2 Sequence: GATATAGTGGATTTCCACATACCA Locus tag: VSAK1_06450 Name: ttrS Funciton: Tetrathionate reduction sensor protein TtrS Locus tag: VSAK1_06445 Name: ttrR Funciton: Tetrathionate reduction response regulator protein TtrR, LuxR family
	VSAK1_06450	ttrS	Tetrathionate reduction sensor protein TtrS
	VSAK1_06445	ttrR	Tetrathionate reduction response regulator protein TtrR, LuxR family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD