Regulon of TtrR in Vibrio parahaemolyticus RIMD 2210633

Properties
Regulator type:	Transcription factor
TF locus tag:	VP2009
Regulator family:	LuxR
Regulation mode:
Biological process:	Tetrathionate reduction
Effector:	Tetrathionate
Regulog:	TtrR - Vibrionales
Statistics of regulated genes:
- Genes	3
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 6 sites [see more]

Member of regulog collections

By taxonomy - Vibrionales
By trascription factor - TtrR
By TF family - LuxR
By effector - Tetrathionate
By pathway - Tetrathionate reduction

Regulated operons
	Locus Tag	Name	Function
Position: -89 Score: 6.4 Sequence: GGGTATGTGGAAATCCACTATATC Locus tag: VP2011 Name: ttrC Funciton: Tetrathionate reductase subunit B
	VP2011	ttrC	Tetrathionate reductase subunit B
Position: -215 Score: 6.4 Sequence: GATATAGTGGATTTCCACATACCC Locus tag: VP2010 Name: ttrS Funciton: Tetrathionate reduction sensor protein TtrS Locus tag: VP2009 Name: ttrR Funciton: Tetrathionate reduction response regulator protein TtrR, LuxR family
	VP2010	ttrS	Tetrathionate reduction sensor protein TtrS
	VP2009	ttrR	Tetrathionate reduction response regulator protein TtrR, LuxR family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD