Regulog MntR - Nocardiaceae
| Regulator type: | Transcription factor |
| Regulator family: | DtxR |
| Regulation mode: | repressor |
| Biological process: | Manganese homeostasis |
| Effector: | Manganese ion, (Mn2+) |
| Phylum: | Actinobacteria |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By trascription factor - MntR
- By taxonomy - Nocardiaceae
- By TF family - DtxR
- By effector - Manganese ion, (Mn2+)
- By pathway - Manganese homeostasis
| Genome | Genes | Operons |
|---|---|---|
| Rhodococcus erythropolis PR4 | 5 | 3 |
| Nocardia farcinica IFM 10152 | 3 | 1 |
| Rhodococcus opacus B4 | 5 | 3 |
| Rhodococcus sp. RHA1 | 5 | 3 |
| Genes | Function | ||||
|---|---|---|---|---|---|
| CRON 1. | |||||
| sodA |
*
Rhodococcus erythropolis PR4 Site: position = -191 score = 5.87908 sequence = TAAGTTCGGTTAACCAAACTTT Gene: RER_01640: Superoxide dismutase [Mn] (EC 1.15.1.1) |
|
*
Rhodococcus opacus B4 Site: position = -189 score = 5.76972 sequence = TTTTTTCGGGTGCCCGAACTTT Gene: ROP_38900: Superoxide dismutase [Mn] (EC 1.15.1.1) |
*
Rhodococcus sp. RHA1 Site: position = -189 score = 5.76972 sequence = TTTTTTCGGGTGCCCGAACTTT Gene: RHA1_ro04009: Superoxide dismutase [Mn] (EC 1.15.1.1) |
Superoxide dismutase [Mn] (EC 1.15.1.1) |
| CRON 2. | |||||
| mntH |
*
Rhodococcus erythropolis PR4 Site: position = -74 score = 6.1416 sequence = AAAGTTCGGCTCCCCGAACTCT Gene: RER_51720: Manganese transport protein, NRAMP family |
|
*
Rhodococcus opacus B4 Site: position = -78 score = 5.32167 sequence = AAAGTTCGTGGTACCTAAATCT Gene: ROP_51290: Manganese transport protein, NRAMP family |
*
Rhodococcus sp. RHA1 Site: position = -77 score = 5.22603 sequence = AAAGTTCGCCATACCTAAATCT Gene: RHA1_ro05067: Manganese transport protein, NRAMP family |
Manganese transport protein, NRAMP family |
| CRON 3. | |||||
| mntC |
*
Rhodococcus erythropolis PR4 Site: position = -55 score = 5.19922 sequence = ATTGTTCGGCTATACGAACTTG Gene: RER_59770: Manganese ABC transporter, periplasmic-binding protein |
*
Nocardia farcinica IFM 10152 Site: position = -35 score = 5.57012 sequence = AAAGTTAGGGCGTCCGAAAATT Gene: nfa24340: Manganese ABC transporter, periplasmic-binding protein |
*
Rhodococcus opacus B4 Site: position = -52 score = 5.47351 sequence = TGGTTTCGGTGAACCGAACATT Gene: ROP_70570: Manganese ABC transporter, periplasmic-binding protein |
*
Rhodococcus sp. RHA1 Site: position = -60 score = 5.45838 sequence = TGGTTTCGGCAAGCCGAACATT Gene: RHA1_ro07271: Manganese ABC transporter, periplasmic-binding protein |
Manganese ABC transporter, periplasmic-binding protein |
| mntA |
Gene: RER_59760: Manganese ABC transporter, ATP-binding protein |
Gene: nfa24350: Manganese ABC transporter, ATP-binding protein |
Gene: ROP_70560: Manganese ABC transporter, ATP-binding protein |
Gene: RHA1_ro07270: Manganese ABC transporter, ATP-binding protein |
Manganese ABC transporter, ATP-binding protein |
| mntB |
Gene: RER_59750: Manganese ABC transporter, inner membrane permease protein |
Gene: nfa24360: Manganese ABC transporter, inner membrane permease protein |
Gene: ROP_70550: Manganese ABC transporter, inner membrane permease protein |
Gene: RHA1_ro07269: Manganese ABC transporter, inner membrane permease protein |
Manganese ABC transporter, inner membrane permease protein |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |