Regulon of MntR in Rhodococcus erythropolis PR4

Properties
Regulator type:	Transcription factor
TF locus tag:	RER_26410
Regulator family:	DtxR
Regulation mode:	repressor
Biological process:	Manganese homeostasis
Effector:	Manganese ion, (Mn2+)
Regulog:	MntR - Nocardiaceae
Statistics of regulated genes:
- Genes	5
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 10 sites [see more]

Member of regulog collections

By trascription factor - MntR
By taxonomy - Nocardiaceae
By TF family - DtxR
By effector - Manganese ion, (Mn2+)
By pathway - Manganese homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -191 Score: 5.9 Sequence: TAAGTTCGGTTAACCAAACTTT Locus tag: RER_01640 Name: sodA Funciton: Superoxide dismutase [Mn] (EC 1.15.1.1)
	RER_01640	sodA	Superoxide dismutase [Mn] (EC 1.15.1.1)
Position: -55 Score: 5.2 Sequence: ATTGTTCGGCTATACGAACTTG Locus tag: RER_59770 Name: mntC Funciton: Manganese ABC transporter, periplasmic-binding protein Locus tag: RER_59760 Name: mntA Funciton: Manganese ABC transporter, ATP-binding protein Locus tag: RER_59750 Name: mntB Funciton: Manganese ABC transporter, inner membrane permease protein
	RER_59770	mntC	Manganese ABC transporter, periplasmic-binding protein
	RER_59760	mntA	Manganese ABC transporter, ATP-binding protein
	RER_59750	mntB	Manganese ABC transporter, inner membrane permease protein
Position: -74 Score: 6.1 Sequence: AAAGTTCGGCTCCCCGAACTCT Locus tag: RER_51720 Name: mntH Funciton: Manganese transport protein, NRAMP family
	RER_51720	mntH	Manganese transport protein, NRAMP family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD