Regulon of MntR in Rhodococcus sp. RHA1

Properties
Regulator type:	Transcription factor
TF locus tag:	RHA1_ro06652
Regulator family:	DtxR
Regulation mode:	repressor
Biological process:	Manganese homeostasis
Effector:	Manganese ion, (Mn2+)
Regulog:	MntR - Nocardiaceae
Statistics of regulated genes:
- Genes	5
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 10 sites [see more]

Member of regulog collections

By trascription factor - MntR
By taxonomy - Nocardiaceae
By TF family - DtxR
By effector - Manganese ion, (Mn2+)
By pathway - Manganese homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -77 Score: 5.2 Sequence: AAAGTTCGCCATACCTAAATCT Locus tag: RHA1_ro05067 Name: mntH Funciton: Manganese transport protein, NRAMP family
	RHA1_ro05067	mntH	Manganese transport protein, NRAMP family
Position: -60 Score: 5.5 Sequence: TGGTTTCGGCAAGCCGAACATT Locus tag: RHA1_ro07271 Name: mntC Funciton: Manganese ABC transporter, periplasmic-binding protein Locus tag: RHA1_ro07270 Name: mntA Funciton: Manganese ABC transporter, ATP-binding protein Locus tag: RHA1_ro07269 Name: mntB Funciton: Manganese ABC transporter, inner membrane permease protein
	RHA1_ro07271	mntC	Manganese ABC transporter, periplasmic-binding protein
	RHA1_ro07270	mntA	Manganese ABC transporter, ATP-binding protein
	RHA1_ro07269	mntB	Manganese ABC transporter, inner membrane permease protein
Position: -189 Score: 5.8 Sequence: TTTTTTCGGGTGCCCGAACTTT Locus tag: RHA1_ro04009 Name: sodA Funciton: Superoxide dismutase [Mn] (EC 1.15.1.1)
	RHA1_ro04009	sodA	Superoxide dismutase [Mn] (EC 1.15.1.1)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD