Regulog Zur - Listeriaceae
| Regulator type: | Transcription factor |
| Regulator family: | FUR |
| Regulation mode: | repressor |
| Biological process: | Zinc homeostasis |
| Effector: | Zinc ion, (Zn2+) |
| Phylum: | Firmicutes |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Listeriaceae
- By trascription factor - Zur
- By TF family - FUR
- By effector - Zinc ion, (Zn2+)
- By pathway - Zinc homeostasis
| Genome | Genes | Operons |
|---|---|---|
| Listeria innocua Clip11262 | 8 | 4 |
| Listeria monocytogenes EGD-e | 8 | 4 |
| Listeria seeligeri serovar 1/2b str. SLCC3954 | 8 | 4 |
| Listeria welshimeri serovar 6b str. SLCC5334 | 8 | 4 |
| Genes | Function | ||||
|---|---|---|---|---|---|
| CRON 1. | |||||
| znuA2 |
*
Listeria innocua Clip11262 Site: position = -37 score = 5.28048 sequence = TAAACAAGAACAATTTCGATTTA Site: position = -69 score = 5.90257 sequence = TAAATCGTAATTGCTACGATTAG Gene: lin1779: Zinc ABC transporter, periplasmic-binding protein ZnuA |
*
Listeria monocytogenes EGD-e Site: position = -69 score = 5.60961 sequence = TAAATCGTAATTGCTACGATTCG Site: position = -37 score = 5.64944 sequence = TAAACAAGAATTATTTCGATTTA Gene: lmo1671: Zinc ABC transporter, periplasmic-binding protein ZnuA |
*
Listeria seeligeri serovar 1/2b str. SLCC3954 Site: position = -37 score = 5.28048 sequence = TAAACAAGAACAATTTCGATTTA Site: position = -69 score = 6.08523 sequence = TAAATCGTAATTACTACGATTGG Gene: lse_1639: Zinc ABC transporter, periplasmic-binding protein ZnuA |
*
Listeria welshimeri serovar 6b str. SLCC5334 Site: position = -37 score = 5.64944 sequence = TAAACAAGAATAATTTCGATTTA Site: position = -69 score = 5.90257 sequence = TAAATCGTAATTGCTACGATTAG Gene: lwe1689: Zinc ABC transporter, periplasmic-binding protein ZnuA |
Zinc ABC transporter, periplasmic-binding protein ZnuA |
| CRON 2. | |||||
| rpsN2 |
*
Listeria innocua Clip11262 Site: position = -38 score = 6.26775 sequence = TAAATCGGAATGATTATTATTTA Gene: lin1995: SSU ribosomal protein S14p |
*
Listeria monocytogenes EGD-e Site: position = -39 score = 6.26775 sequence = TAAATCGGAATGATTATTATTTA Gene: lmo1882: SSU ribosomal protein S14p |
*
Listeria seeligeri serovar 1/2b str. SLCC3954 Site: position = -38 score = 6.48446 sequence = TAAATCGGAATTATTACTATTTA Gene: lse_1865: SSU ribosomal protein S14p |
*
Listeria welshimeri serovar 6b str. SLCC5334 Site: position = -39 score = 6.26775 sequence = TAAATCGGAATGATTATTATTTA Gene: lwe1901: SSU ribosomal protein S14p |
SSU ribosomal protein S14p |
| CRON 3. | |||||
| znuA |
*
Listeria innocua Clip11262 Site: position = -34 score = 6.11825 sequence = TAAATCGTAATCATTACGAAAAA Site: position = -97 score = 5.86313 sequence = CAAATAAGAATGATTACGTTTTA Gene: lin0191: Zinc ABC transporter, periplasmic-binding protein ZnuA |
*
Listeria monocytogenes EGD-e Site: position = -97 score = 5.75329 sequence = CAAATAAGAATTATTACGTTTTG Site: position = -34 score = 6.11825 sequence = TAAATCGTAATCATTACGAAAAA Gene: lmo0153: Zinc ABC transporter, periplasmic-binding protein ZnuA |
*
Listeria seeligeri serovar 1/2b str. SLCC3954 Site: position = -96 score = 5.73932 sequence = CAAATAAGAATGATTACGTTTTG Site: position = -32 score = 5.99444 sequence = TAAATCGTAATCATTACGAAAAG Gene: lse_0133: Zinc ABC transporter, periplasmic-binding protein ZnuA |
*
Listeria welshimeri serovar 6b str. SLCC5334 Site: position = -97 score = 5.73932 sequence = CAAATAAGAATGATTACGTTTTG Site: position = -34 score = 6.11825 sequence = TAAATCGTAATCATTACGAAAAA Gene: lwe0129: Zinc ABC transporter, periplasmic-binding protein ZnuA |
Zinc ABC transporter, periplasmic-binding protein ZnuA |
| znuC |
Gene: lin0192: Zinc ABC transporter, ATP-binding protein ZnuC |
Gene: lmo0154: Zinc ABC transporter, ATP-binding protein ZnuC |
Gene: lse_0134: Zinc ABC transporter, ATP-binding protein ZnuC |
Gene: lwe0130: Zinc ABC transporter, ATP-binding protein ZnuC |
Zinc ABC transporter, ATP-binding protein ZnuC |
| znuB |
Gene: lin0193: Zinc ABC transporter, inner membrane permease protein ZnuB |
Gene: lmo0155: Zinc ABC transporter, inner membrane permease protein ZnuB |
Gene: lse_0135: Zinc ABC transporter, inner membrane permease protein ZnuB |
Gene: lwe0131: Zinc ABC transporter, inner membrane permease protein ZnuB |
Zinc ABC transporter, inner membrane permease protein ZnuB |
| CRON 4. | |||||
| znuC2 |
*
Listeria innocua Clip11262 Site: position = -89 score = 6.2221 sequence = TAATTCGAAGTAATTACGATTTA Gene: lin1485: Zinc ABC transporter, ATP-binding protein ZnuC |
*
Listeria monocytogenes EGD-e Site: position = -89 score = 6.2221 sequence = TAATTCGAAGTAATTACGATTTA Gene: lmo1447: Zinc ABC transporter, ATP-binding protein ZnuC |
*
Listeria seeligeri serovar 1/2b str. SLCC3954 Site: position = -88 score = 6.2221 sequence = TAATTCGAAGTTATTACGATTTA Gene: lse_1365: Zinc ABC transporter, ATP-binding protein ZnuC |
*
Listeria welshimeri serovar 6b str. SLCC5334 Site: position = -89 score = 6.2221 sequence = TAATTCGAAGTAATTACGATTTA Gene: lwe1463: Zinc ABC transporter, ATP-binding protein ZnuC |
Zinc ABC transporter, ATP-binding protein ZnuC |
| znuB2 |
Gene: lin1484: Zinc ABC transporter, inner membrane permease protein ZnuB |
Gene: lmo1446: Zinc ABC transporter, inner membrane permease protein ZnuB |
Gene: lse_1364: Zinc ABC transporter, inner membrane permease protein ZnuB |
Gene: lwe1462: Zinc ABC transporter, inner membrane permease protein ZnuB |
Zinc ABC transporter, inner membrane permease protein ZnuB |
| zur |
Gene: lin1483: Zinc homeostasis transcriptional regulator Zur, Fur family |
Gene: lmo1445: Zinc homeostasis transcriptional regulator Zur, Fur family |
Gene: lse_1363: Zinc homeostasis transcriptional regulator Zur, Fur family |
Gene: lwe1461: Zinc homeostasis transcriptional regulator Zur, Fur family |
Zinc homeostasis transcriptional regulator Zur, Fur family |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |