Regulon of Zur in Listeria welshimeri serovar 6b str. SLCC5334

Properties
Regulator type:	Transcription factor
TF locus tag:	lwe1461
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Regulog:	Zur - Listeriaceae
Statistics of regulated genes:
- Genes	8
- Operons	4
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 24 sites [see more]

Member of regulog collections

By taxonomy - Listeriaceae
By trascription factor - Zur
By TF family - FUR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -97 Score: 5.7 Sequence: CAAATAAGAATGATTACGTTTTG Position: -34 Score: 6.1 Sequence: TAAATCGTAATCATTACGAAAAA Locus tag: lwe0129 Name: znuA Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA Locus tag: lwe0130 Name: znuC Funciton: Zinc ABC transporter, ATP-binding protein ZnuC Locus tag: lwe0131 Name: znuB Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
	lwe0129	znuA	Zinc ABC transporter, periplasmic-binding protein ZnuA
	lwe0130	znuC	Zinc ABC transporter, ATP-binding protein ZnuC
	lwe0131	znuB	Zinc ABC transporter, inner membrane permease protein ZnuB
Position: -89 Score: 6.2 Sequence: TAATTCGAAGTAATTACGATTTA Locus tag: lwe1463 Name: znuC2 Funciton: Zinc ABC transporter, ATP-binding protein ZnuC Locus tag: lwe1462 Name: znuB2 Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB Locus tag: lwe1461 Name: zur Funciton: Zinc homeostasis transcriptional regulator Zur, Fur family
	lwe1463	znuC2	Zinc ABC transporter, ATP-binding protein ZnuC
	lwe1462	znuB2	Zinc ABC transporter, inner membrane permease protein ZnuB
	lwe1461	zur	Zinc homeostasis transcriptional regulator Zur, Fur family
Position: -69 Score: 5.9 Sequence: TAAATCGTAATTGCTACGATTAG Position: -37 Score: 5.6 Sequence: TAAACAAGAATAATTTCGATTTA Locus tag: lwe1689 Name: znuA2 Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
	lwe1689	znuA2	Zinc ABC transporter, periplasmic-binding protein ZnuA
Position: -39 Score: 6.3 Sequence: TAAATCGGAATGATTATTATTTA Locus tag: lwe1901 Name: rpsN2 Funciton: SSU ribosomal protein S14p
	lwe1901	rpsN2	SSU ribosomal protein S14p

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD