Regulon of Zur in Listeria innocua Clip11262

Properties
Regulator type:	Transcription factor
TF locus tag:	lin1483
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Regulog:	Zur - Listeriaceae
Statistics of regulated genes:
- Genes	8
- Operons	4
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 24 sites [see more]

Member of regulog collections

By taxonomy - Listeriaceae
By trascription factor - Zur
By TF family - FUR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -97 Score: 5.9 Sequence: CAAATAAGAATGATTACGTTTTA Position: -34 Score: 6.1 Sequence: TAAATCGTAATCATTACGAAAAA Locus tag: lin0191 Name: znuA Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA Locus tag: lin0192 Name: znuC Funciton: Zinc ABC transporter, ATP-binding protein ZnuC Locus tag: lin0193 Name: znuB Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
	lin0191	znuA	Zinc ABC transporter, periplasmic-binding protein ZnuA
	lin0192	znuC	Zinc ABC transporter, ATP-binding protein ZnuC
	lin0193	znuB	Zinc ABC transporter, inner membrane permease protein ZnuB
Position: -69 Score: 5.9 Sequence: TAAATCGTAATTGCTACGATTAG Position: -37 Score: 5.3 Sequence: TAAACAAGAACAATTTCGATTTA Locus tag: lin1779 Name: znuA2 Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
	lin1779	znuA2	Zinc ABC transporter, periplasmic-binding protein ZnuA
Position: -89 Score: 6.2 Sequence: TAATTCGAAGTAATTACGATTTA Locus tag: lin1485 Name: znuC2 Funciton: Zinc ABC transporter, ATP-binding protein ZnuC Locus tag: lin1484 Name: znuB2 Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB Locus tag: lin1483 Name: zur Funciton: Zinc homeostasis transcriptional regulator Zur, Fur family
	lin1485	znuC2	Zinc ABC transporter, ATP-binding protein ZnuC
	lin1484	znuB2	Zinc ABC transporter, inner membrane permease protein ZnuB
	lin1483	zur	Zinc homeostasis transcriptional regulator Zur, Fur family
Position: -38 Score: 6.3 Sequence: TAAATCGGAATGATTATTATTTA Locus tag: lin1995 Name: rpsN2 Funciton: SSU ribosomal protein S14p
	lin1995	rpsN2	SSU ribosomal protein S14p

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD