Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing znuC2 gene

Properties
Regulog: Zur - Listeriaceae
Regulator type: Transcription factor
Regulator family: FUR
Regulation mode: repressor
Biological process: Zinc homeostasis
Effector: Zinc ion, (Zn2+)
Phylum: Firmicutes
Built upon 24 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Listeria innocua Clip11262
Position: -89
Score: 6.2221
Sequence: TAATTCGAAGTAATTACGATTTA
Locus tag: lin1485
Name: znuC2
Funciton: Zinc ABC transporter, ATP-binding protein ZnuC
Locus tag: lin1484
Name: znuB2
Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
Locus tag: lin1483
Name: zur
Funciton: Zinc homeostasis transcriptional regulator Zur, Fur family
znuC2-znuB2-zur -89 6.2 TAATTCGAAGTAATTACGATTTA lin1485
Listeria monocytogenes EGD-e
Position: -89
Score: 6.2221
Sequence: TAATTCGAAGTAATTACGATTTA
Locus tag: lmo1447
Name: znuC2
Funciton: Zinc ABC transporter, ATP-binding protein ZnuC
Locus tag: lmo1446
Name: znuB2
Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
Locus tag: lmo1445
Name: zur
Funciton: Zinc homeostasis transcriptional regulator Zur, Fur family
znuC2-znuB2-zur -89 6.2 TAATTCGAAGTAATTACGATTTA lmo1447
Listeria seeligeri serovar 1/2b str. SLCC3954
Position: -88
Score: 6.2221
Sequence: TAATTCGAAGTTATTACGATTTA
Locus tag: lse_1365
Name: znuC2
Funciton: Zinc ABC transporter, ATP-binding protein ZnuC
Locus tag: lse_1364
Name: znuB2
Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
Locus tag: lse_1363
Name: zur
Funciton: Zinc homeostasis transcriptional regulator Zur, Fur family
znuC2-znuB2-zur -88 6.2 TAATTCGAAGTTATTACGATTTA lse_1365
Listeria welshimeri serovar 6b str. SLCC5334
Position: -89
Score: 6.2221
Sequence: TAATTCGAAGTAATTACGATTTA
Locus tag: lwe1463
Name: znuC2
Funciton: Zinc ABC transporter, ATP-binding protein ZnuC
Locus tag: lwe1462
Name: znuB2
Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
Locus tag: lwe1461
Name: zur
Funciton: Zinc homeostasis transcriptional regulator Zur, Fur family
znuC2-znuB2-zur -89 6.2 TAATTCGAAGTAATTACGATTTA lwe1463