Regulog MntR - Clostridia-1
| Regulator type: | Transcription factor |
| Regulator family: | DtxR |
| Regulation mode: | repressor |
| Biological process: | Manganese homeostasis |
| Effector: | Manganese ion, (Mn2+) |
| Phylum: | Firmicutes |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Clostridia-1
- By trascription factor - MntR
- By TF family - DtxR
- By effector - Manganese ion, (Mn2+)
- By pathway - Manganese homeostasis
| Genome | Genes | Operons |
|---|---|---|
| Clostridium acetobutylicum ATCC 824 | 1 | 1 |
| Clostridium beijerincki NCIMB 8052 | 2 | 2 |
| Clostridium botulinum A str. ATCC 3502 | ||
| Clostridium butyricum 5521 | ||
| Clostridium kluyveri DSM 555 | ||
| Clostridium novyi NT | 3 | 2 |
| Clostridium perfringens ATCC 13124 | ||
| Clostridium tetani E88 |
| Genes | Function | ||||||||
|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||
| mntH |
*
Clostridium acetobutylicum ATCC 824 Site: position = -78 score = 6.17018 sequence = AAATTTAGTTTAATCTAACTTT Gene: CAP0063: Manganese transport protein, NRAMP family |
*
Clostridium beijerincki NCIMB 8052 Site: position = -109 score = 5.96712 sequence = TAATTTAGACTAGGCTAAGAAA Gene: Cbei_4070: Manganese transport protein, NRAMP family |
|
|
|
|
|
|
Manganese transport protein, NRAMP family |
| CRON 2. | |||||||||
| mntR |
Gene: CAC2616: Mn-dependent transcriptional regulator, DtxR family |
*
Clostridium beijerincki NCIMB 8052 Site: position = -133 score = 5.96712 sequence = TTTCTTAGCCTAGTCTAAATTA Gene: Cbei_4069: Mn-dependent transcriptional regulator, DtxR family |
|
|
|
*
Clostridium novyi NT Site: position = -164 score = 6.81199 sequence = AAAATTAGCTTAGTCTAACTTT Gene: NT01CX_2309: Mn-dependent transcriptional regulator, DtxR family |
|
|
Mn-dependent transcriptional regulator, DtxR family |
| CRON 3. | |||||||||
| feoA |
|
2
Clostridium beijerincki NCIMB 8052 Gene: Cbei_4198: Ferrous iron transport protein A Gene: Cbei_4197: Ferrous iron transport protein A |
Gene: CBO0816: Ferrous iron transport protein A |
Gene: CBY_3866: Ferrous iron transport protein A |
Gene: CKL_0949: Ferrous iron transport protein A |
*
Clostridium novyi NT Site: position = -65 score = 6.81199 sequence = AAAGTTAGACTAAGCTAATTTT Gene: NT01CX_2308: Ferrous iron transport protein A |
Gene: CPF_1010: Ferrous iron transport protein A |
|
Ferrous iron transport protein A |
| feoB |
|
Gene: Cbei_4196: Ferrous iron transport protein B |
2
Clostridium botulinum A str. ATCC 3502 Gene: CBO0818: Ferrous iron transport protein B Gene: CBO0817: Ferrous iron transport protein B |
Gene: CBY_3867: Ferrous iron transport protein B |
Gene: CKL_0948: Ferrous iron transport protein B |
Gene: NT01CX_2307: Ferrous iron transport protein B |
Gene: CPF_1009: Ferrous iron transport protein B |
|
Ferrous iron transport protein B |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |