Regulon of MntR in Clostridium beijerincki NCIMB 8052

Properties
Regulator type:	Transcription factor
TF locus tag:	Cbei_4069
Regulator family:	DtxR
Regulation mode:	repressor
Biological process:	Manganese homeostasis
Effector:	Manganese ion, (Mn2+)
Regulog:	MntR - Clostridia-1
Statistics of regulated genes:
- Genes	2
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 5 sites [see more]

Member of regulog collections

By taxonomy - Clostridia-1
By trascription factor - MntR
By TF family - DtxR
By effector - Manganese ion, (Mn2+)
By pathway - Manganese homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -109 Score: 6 Sequence: TAATTTAGACTAGGCTAAGAAA Locus tag: Cbei_4070 Name: mntH Funciton: Manganese transport protein, NRAMP family
	Cbei_4070	mntH	Manganese transport protein, NRAMP family
Position: -133 Score: 6 Sequence: TTTCTTAGCCTAGTCTAAATTA Locus tag: Cbei_4069 Name: mntR Funciton: Mn-dependent transcriptional regulator, DtxR family
	Cbei_4069	mntR	Mn-dependent transcriptional regulator, DtxR family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD