Regulon of MntR in Clostridium novyi NT

Properties
Regulator type:	Transcription factor
TF locus tag:	NT01CX_2309
Regulator family:	DtxR
Regulation mode:	repressor
Biological process:	Manganese homeostasis
Effector:	Manganese ion, (Mn2+)
Regulog:	MntR - Clostridia-1
Statistics of regulated genes:
- Genes	3
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 5 sites [see more]

Member of regulog collections

By taxonomy - Clostridia-1
By trascription factor - MntR
By TF family - DtxR
By effector - Manganese ion, (Mn2+)
By pathway - Manganese homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -164 Score: 6.8 Sequence: AAAATTAGCTTAGTCTAACTTT Locus tag: NT01CX_2309 Name: mntR Funciton: Mn-dependent transcriptional regulator, DtxR family
	NT01CX_2309	mntR	Mn-dependent transcriptional regulator, DtxR family
Position: -65 Score: 6.8 Sequence: AAAGTTAGACTAAGCTAATTTT Locus tag: NT01CX_2308 Name: feoA Funciton: Ferrous iron transport protein A Locus tag: NT01CX_2307 Name: feoB Funciton: Ferrous iron transport protein B
	NT01CX_2308	feoA	Ferrous iron transport protein A
	NT01CX_2307	feoB	Ferrous iron transport protein B

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD