Regulon of MntR in Clostridium acetobutylicum ATCC 824
| Regulator type: | Transcription factor |
| TF locus tag: | CAC2616 |
| Regulator family: | DtxR |
| Regulation mode: | repressor |
| Biological process: | Manganese homeostasis |
| Effector: | Manganese ion, (Mn2+) |
| Regulog: | MntR - Clostridia-1 |
| Statistics of regulated genes: | |
| - Genes | 1 |
| - Operons | 1 |
| Visualization: | |
|
Allows to visualize regulon content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Clostridia-1
- By trascription factor - MntR
- By TF family - DtxR
- By effector - Manganese ion, (Mn2+)
- By pathway - Manganese homeostasis
| Locus Tag | Name | Function | |
|---|---|---|---|
|
Position: -78
Score: 6.2 Sequence: AAATTTAGTTTAATCTAACTTT
Locus tag: CAP0063
Name: mntH Funciton: Manganese transport protein, NRAMP family |
|||
|
mntH
|
Manganese transport protein, NRAMP family
|
||
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |