Regulon of MntR in Clostridium acetobutylicum ATCC 824

Properties
Regulator type:	Transcription factor
TF locus tag:	CAC2616
Regulator family:	DtxR
Regulation mode:	repressor
Biological process:	Manganese homeostasis
Effector:	Manganese ion, (Mn2+)
Regulog:	MntR - Clostridia-1
Statistics of regulated genes:
- Genes	1
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 5 sites [see more]

Member of regulog collections

By taxonomy - Clostridia-1
By trascription factor - MntR
By TF family - DtxR
By effector - Manganese ion, (Mn2+)
By pathway - Manganese homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -78 Score: 6.2 Sequence: AAATTTAGTTTAATCTAACTTT Locus tag: CAP0063 Name: mntH Funciton: Manganese transport protein, NRAMP family
	CAP0063	mntH	Manganese transport protein, NRAMP family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD