Regulog SO3393 - Shewanellaceae
| Regulator type: | Transcription factor |
| Regulator family: | TetR |
| Regulation mode: | repressor |
| Biological process: | Drug resistance |
| Effector: | |
| Phylum: | Proteobacteria/gamma |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Shewanellaceae
- By TF family - TetR
- By pathway - Drug resistance
| Genome | Genes | Operons |
|---|---|---|
| Shewanella oneidensis MR-1 | 2 | 2 |
| Shewanella putrefaciens CN-32 | 2 | 2 |
| Shewanella sp W3-18-1 | 2 | 2 |
| Shewanella sp ANA-3 | 2 | 2 |
| Shewanella sp MR-4 | 2 | 2 |
| Shewanella sp MR-7 | 2 | 2 |
| Shewanella baltica OS155 | 2 | 2 |
| Shewanella denitrificans OS217 | 2 | 2 |
| Shewanella frigidimarina NCIMB 400 | 2 | 2 |
| Shewanella amazonensis SB2B | 2 | 2 |
| Shewanella loihica PV-4 | 2 | 2 |
| Shewanella pealeana ATCC 700345 | ||
| Shewanella halifaxensis HAW-EB4 | ||
| Shewanella piezotolerans WP3 | 2 | 2 |
| Shewanella sediminis HAW-EB3 | 2 | 2 |
| Shewanella woodyi ATCC 51908 | 2 | 2 |
| Genes | Function | ||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||||||||||
| SO3393 |
*
Shewanella oneidensis MR-1 Site: position = -64 score = 5.53553 sequence = TTTTGAATGTTTGTTCAATA Site: position = -88 score = 5.75477 sequence = ATTTGAATGATCATTCAAGA Site: position = -115 score = 7.03966 sequence = TCTTGAATGTACGTTCAAGA Gene: SO_3393: Transcriptional regulator, TetR family |
*
Shewanella putrefaciens CN-32 Site: position = -68 score = 5.53553 sequence = TTTTGAATGTTTGTTCAAAA Site: position = -92 score = 5.42819 sequence = ATTTGAATGAACATTCAAGT Site: position = -119 score = 7.16778 sequence = TCTTGAATGTGCATTCAAGA Gene: Sputcn32_2721: Transcriptional regulator, TetR family |
*
Shewanella sp W3-18-1 Site: position = -68 score = 5.53553 sequence = TTTTGAATGTTTGTTCAAAA Site: position = -92 score = 5.42819 sequence = ATTTGAATGAACATTCAAGT Site: position = -119 score = 7.16778 sequence = TCTTGAATGTGCATTCAAGA Gene: Sputw3181_1291: Transcriptional regulator, TetR family |
*
Shewanella sp ANA-3 Site: position = -63 score = 5.53553 sequence = TTTTGAATGTTTGTTCAAAA Site: position = -87 score = 5.53924 sequence = ATTTGAACGATCATTCAAGA Site: position = -114 score = 7.16778 sequence = TCTTGAATGTGCATTCAAGA Gene: Shewana3_1158: Transcriptional regulator, TetR family |
*
Shewanella sp MR-4 Site: position = -64 score = 5.53553 sequence = TTTTGAATGTTTGTTCAAAA Site: position = -88 score = 5.53924 sequence = ATTTGAACGATCATTCAAGA Site: position = -115 score = 7.16778 sequence = TCTTGAATGTGCATTCAAGA Gene: Shewmr4_1157: Transcriptional regulator, TetR family |
*
Shewanella sp MR-7 Site: position = -64 score = 5.53553 sequence = TTTTGAATGTTTGTTCAAAA Site: position = -88 score = 5.53924 sequence = ATTTGAACGATCATTCAAGA Site: position = -115 score = 6.95225 sequence = TCTTGAATATGCATTCAAGA Gene: Shewmr7_1228: Transcriptional regulator, TetR family |
*
Shewanella baltica OS155 Site: position = -68 score = 5.96658 sequence = TTTTGAATGTTCATTCAAAA Site: position = -92 score = 5.00085 sequence = ATTTGAACGATCATTCAAGT Site: position = -119 score = 6.95225 sequence = TCTTGAATATGCATTCAAGA Gene: Sbal_1248: Transcriptional regulator, TetR family |
*
Shewanella denitrificans OS217 Site: position = 41 score = 4.99714 sequence = ATTTGAACATTCATTCAAGT Site: position = 14 score = 7.16778 sequence = TCTTGAATGTGCATTCAAGA Gene: Sden_1229: Transcriptional regulator, TetR family |
*
Shewanella frigidimarina NCIMB 400 Site: position = -103 score = 5.55261 sequence = AATTGAATGCACATTCAAGT Site: position = -131 score = 6.95225 sequence = TCTTGAATATGCATTCAAGA Gene: Sfri_1088: Transcriptional regulator, TetR family |
*
Shewanella amazonensis SB2B Site: position = -62 score = 5.74735 sequence = TTTTGAACATACATTCAAAA Site: position = -86 score = 6.82413 sequence = TCTTGAACATACATTCAAGA Site: position = -113 score = 5.21036 sequence = TTTTGAACAGGCATTCAAAA Gene: Sama_2408: Transcriptional regulator, TetR family |
*
Shewanella loihica PV-4 Site: position = -67 score = 5.75106 sequence = TTTTGAACGTTCATTCAAAA Site: position = -118 score = 6.74044 sequence = TCTTGAATGAGCGTTCAAGA Gene: Shew_3099: Transcriptional regulator, TetR family |
|
|
*
Shewanella piezotolerans WP3 Site: position = 49 score = 5.53553 sequence = TTTTGAACAAACATTCAAAA Site: position = -2 score = 7.04337 sequence = TCTTGAATGAACATTCAAGA Site: position = 25 score = 5.00085 sequence = ATTTGAATAATCATTCAAGT Gene: swp_0976: Transcriptional regulator, TetR family |
*
Shewanella sediminis HAW-EB3 Site: position = -77 score = 5.53553 sequence = TTTTGAACAAACATTCAAAA Site: position = -101 score = 5.00085 sequence = ATTTGAACGATCATTCAAGT Site: position = -128 score = 7.04337 sequence = TCTTGAATGTTCATTCAAGA Gene: Ssed_3643: Transcriptional regulator, TetR family |
*
Shewanella woodyi ATCC 51908 Site: position = -62 score = 5.53553 sequence = TTTTGAACAAACATTCAAAA Site: position = -113 score = 7.04337 sequence = TCTTGAATGTTCATTCAAGA Site: position = -86 score = 5.00085 sequence = ATTTGAACGATCATTCAAGT Gene: Swoo_4056: Transcriptional regulator, TetR family |
Transcriptional regulator, TetR family |
| CRON 2. | |||||||||||||||||
| SO3392 |
*
Shewanella oneidensis MR-1 Site: position = -34 score = 7.03966 sequence = TCTTGAACGTACATTCAAGA Site: position = -85 score = 5.53553 sequence = TATTGAACAAACATTCAAAA Site: position = -61 score = 5.75477 sequence = TCTTGAATGATCATTCAAAT Gene: SO_3392: NADH-dependent flavin oxidoreductase, Oye family |
*
Shewanella putrefaciens CN-32 Site: position = -34 score = 7.16778 sequence = TCTTGAATGCACATTCAAGA Site: position = -85 score = 5.53553 sequence = TTTTGAACAAACATTCAAAA Site: position = -61 score = 5.42819 sequence = ACTTGAATGTTCATTCAAAT Gene: Sputcn32_2720: NADH-dependent flavin oxidoreductase, Oye family |
*
Shewanella sp W3-18-1 Site: position = -34 score = 7.16778 sequence = TCTTGAATGCACATTCAAGA Site: position = -85 score = 5.53553 sequence = TTTTGAACAAACATTCAAAA Site: position = -61 score = 5.42819 sequence = ACTTGAATGTTCATTCAAAT Gene: Sputw3181_1292: NADH-dependent flavin oxidoreductase, Oye family |
*
Shewanella sp ANA-3 Site: position = -34 score = 7.16778 sequence = TCTTGAATGCACATTCAAGA Site: position = -85 score = 5.53553 sequence = TTTTGAACAAACATTCAAAA Site: position = -61 score = 5.53924 sequence = TCTTGAATGATCGTTCAAAT Gene: Shewana3_1159: NADH-dependent flavin oxidoreductase, Oye family |
*
Shewanella sp MR-4 Site: position = -34 score = 7.16778 sequence = TCTTGAATGCACATTCAAGA Site: position = -85 score = 5.53553 sequence = TTTTGAACAAACATTCAAAA Site: position = -61 score = 5.53924 sequence = TCTTGAATGATCGTTCAAAT Gene: Shewmr4_1158: NADH-dependent flavin oxidoreductase, Oye family |
*
Shewanella sp MR-7 Site: position = -34 score = 6.95225 sequence = TCTTGAATGCATATTCAAGA Site: position = -85 score = 5.53553 sequence = TTTTGAACAAACATTCAAAA Site: position = -61 score = 5.53924 sequence = TCTTGAATGATCGTTCAAAT Gene: Shewmr7_1229: NADH-dependent flavin oxidoreductase, Oye family |
*
Shewanella baltica OS155 Site: position = -34 score = 6.95225 sequence = TCTTGAATGCATATTCAAGA Site: position = -85 score = 5.96658 sequence = TTTTGAATGAACATTCAAAA Site: position = -61 score = 5.00085 sequence = ACTTGAATGATCGTTCAAAT Gene: Sbal_1249: NADH-dependent flavin oxidoreductase, Oye family |
*
Shewanella denitrificans OS217 Site: position = -32 score = 7.16778 sequence = TCTTGAATGCACATTCAAGA Site: position = -59 score = 4.99714 sequence = ACTTGAATGAATGTTCAAAT Gene: Sden_1230: NADH-dependent flavin oxidoreductase, Oye family |
*
Shewanella frigidimarina NCIMB 400 Site: position = -62 score = 5.55261 sequence = ACTTGAATGTGCATTCAATT Site: position = -34 score = 6.95225 sequence = TCTTGAATGCATATTCAAGA Gene: Sfri_1089: NADH-dependent flavin oxidoreductase, Oye family |
*
Shewanella amazonensis SB2B Site: position = -35 score = 5.21036 sequence = TTTTGAATGCCTGTTCAAAA Site: position = -62 score = 6.82413 sequence = TCTTGAATGTATGTTCAAGA Site: position = -86 score = 5.74735 sequence = TTTTGAATGTATGTTCAAAA Gene: Sama_2407: NADH-dependent flavin oxidoreductase, Oye family |
*
Shewanella loihica PV-4 Site: position = -33 score = 6.74044 sequence = TCTTGAACGCTCATTCAAGA Site: position = -84 score = 5.75106 sequence = TTTTGAATGAACGTTCAAAA Gene: Shew_3098: NADH-dependent flavin oxidoreductase, Oye family |
|
|
*
Shewanella piezotolerans WP3 Site: position = -33 score = 7.04337 sequence = TCTTGAATGTTCATTCAAGA Site: position = -60 score = 5.00085 sequence = ACTTGAATGATTATTCAAAT Site: position = -84 score = 5.53553 sequence = TTTTGAATGTTTGTTCAAAA Gene: swp_0975: NADH-dependent flavin oxidoreductase, Oye family |
*
Shewanella sediminis HAW-EB3 Site: position = -33 score = 7.04337 sequence = TCTTGAATGAACATTCAAGA Site: position = -84 score = 5.53553 sequence = TTTTGAATGTTTGTTCAAAA Site: position = -60 score = 5.00085 sequence = ACTTGAATGATCGTTCAAAT Gene: Ssed_3644: NADH-dependent flavin oxidoreductase, Oye family |
*
Shewanella woodyi ATCC 51908 Site: position = -33 score = 7.04337 sequence = TCTTGAATGAACATTCAAGA Site: position = -84 score = 5.53553 sequence = TTTTGAATGTTTGTTCAAAA Site: position = -60 score = 5.00085 sequence = ACTTGAATGATCGTTCAAAT Gene: Swoo_4055: NADH-dependent flavin oxidoreductase, Oye family |
NADH-dependent flavin oxidoreductase, Oye family |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |