Regulog SO3393 - Shewanellaceae

Properties
Regulator type:	Transcription factor
Regulator family:	TetR
Regulation mode:	repressor
Biological process:	Drug resistance
Effector:
Phylum:	Proteobacteria/gamma
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 78 sites [see more]

Member of regulog collections

By taxonomy - Shewanellaceae
By TF family - TetR
By pathway - Drug resistance

Statistics of regulated genes
Genome	Genes	Operons
Shewanella oneidensis MR-1	2	2
Shewanella putrefaciens CN-32	2	2
Shewanella sp W3-18-1	2	2
Shewanella sp ANA-3	2	2
Shewanella sp MR-4	2	2
Shewanella sp MR-7	2	2
Shewanella baltica OS155	2	2
Shewanella denitrificans OS217	2	2
Shewanella frigidimarina NCIMB 400	2	2
Shewanella amazonensis SB2B	2	2
Shewanella loihica PV-4	2	2
Shewanella pealeana ATCC 700345
Shewanella halifaxensis HAW-EB4
Shewanella piezotolerans WP3	2	2
Shewanella sediminis HAW-EB3	2	2
Shewanella woodyi ATCC 51908	2	2

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes																	Function

CRON 1.
SO3393	* Shewanella oneidensis MR-1 Site: position = -64 score = 5.53553 sequence = TTTTGAATGTTTGTTCAATA Site: position = -88 score = 5.75477 sequence = ATTTGAATGATCATTCAAGA Site: position = -115 score = 7.03966 sequence = TCTTGAATGTACGTTCAAGA Gene: SO_3393: Transcriptional regulator, TetR family	* Shewanella putrefaciens CN-32 Site: position = -68 score = 5.53553 sequence = TTTTGAATGTTTGTTCAAAA Site: position = -92 score = 5.42819 sequence = ATTTGAATGAACATTCAAGT Site: position = -119 score = 7.16778 sequence = TCTTGAATGTGCATTCAAGA Gene: Sputcn32_2721: Transcriptional regulator, TetR family	* Shewanella sp W3-18-1 Site: position = -68 score = 5.53553 sequence = TTTTGAATGTTTGTTCAAAA Site: position = -92 score = 5.42819 sequence = ATTTGAATGAACATTCAAGT Site: position = -119 score = 7.16778 sequence = TCTTGAATGTGCATTCAAGA Gene: Sputw3181_1291: Transcriptional regulator, TetR family	* Shewanella sp ANA-3 Site: position = -63 score = 5.53553 sequence = TTTTGAATGTTTGTTCAAAA Site: position = -87 score = 5.53924 sequence = ATTTGAACGATCATTCAAGA Site: position = -114 score = 7.16778 sequence = TCTTGAATGTGCATTCAAGA Gene: Shewana3_1158: Transcriptional regulator, TetR family	* Shewanella sp MR-4 Site: position = -64 score = 5.53553 sequence = TTTTGAATGTTTGTTCAAAA Site: position = -88 score = 5.53924 sequence = ATTTGAACGATCATTCAAGA Site: position = -115 score = 7.16778 sequence = TCTTGAATGTGCATTCAAGA Gene: Shewmr4_1157: Transcriptional regulator, TetR family	* Shewanella sp MR-7 Site: position = -64 score = 5.53553 sequence = TTTTGAATGTTTGTTCAAAA Site: position = -88 score = 5.53924 sequence = ATTTGAACGATCATTCAAGA Site: position = -115 score = 6.95225 sequence = TCTTGAATATGCATTCAAGA Gene: Shewmr7_1228: Transcriptional regulator, TetR family	* Shewanella baltica OS155 Site: position = -68 score = 5.96658 sequence = TTTTGAATGTTCATTCAAAA Site: position = -92 score = 5.00085 sequence = ATTTGAACGATCATTCAAGT Site: position = -119 score = 6.95225 sequence = TCTTGAATATGCATTCAAGA Gene: Sbal_1248: Transcriptional regulator, TetR family	* Shewanella denitrificans OS217 Site: position = 41 score = 4.99714 sequence = ATTTGAACATTCATTCAAGT Site: position = 14 score = 7.16778 sequence = TCTTGAATGTGCATTCAAGA Gene: Sden_1229: Transcriptional regulator, TetR family	* Shewanella frigidimarina NCIMB 400 Site: position = -103 score = 5.55261 sequence = AATTGAATGCACATTCAAGT Site: position = -131 score = 6.95225 sequence = TCTTGAATATGCATTCAAGA Gene: Sfri_1088: Transcriptional regulator, TetR family	* Shewanella amazonensis SB2B Site: position = -62 score = 5.74735 sequence = TTTTGAACATACATTCAAAA Site: position = -86 score = 6.82413 sequence = TCTTGAACATACATTCAAGA Site: position = -113 score = 5.21036 sequence = TTTTGAACAGGCATTCAAAA Gene: Sama_2408: Transcriptional regulator, TetR family	* Shewanella loihica PV-4 Site: position = -67 score = 5.75106 sequence = TTTTGAACGTTCATTCAAAA Site: position = -118 score = 6.74044 sequence = TCTTGAATGAGCGTTCAAGA Gene: Shew_3099: Transcriptional regulator, TetR family	Shewanella pealeana ATCC 700345	Shewanella halifaxensis HAW-EB4	* Shewanella piezotolerans WP3 Site: position = 49 score = 5.53553 sequence = TTTTGAACAAACATTCAAAA Site: position = -2 score = 7.04337 sequence = TCTTGAATGAACATTCAAGA Site: position = 25 score = 5.00085 sequence = ATTTGAATAATCATTCAAGT Gene: swp_0976: Transcriptional regulator, TetR family	* Shewanella sediminis HAW-EB3 Site: position = -77 score = 5.53553 sequence = TTTTGAACAAACATTCAAAA Site: position = -101 score = 5.00085 sequence = ATTTGAACGATCATTCAAGT Site: position = -128 score = 7.04337 sequence = TCTTGAATGTTCATTCAAGA Gene: Ssed_3643: Transcriptional regulator, TetR family	* Shewanella woodyi ATCC 51908 Site: position = -62 score = 5.53553 sequence = TTTTGAACAAACATTCAAAA Site: position = -113 score = 7.04337 sequence = TCTTGAATGTTCATTCAAGA Site: position = -86 score = 5.00085 sequence = ATTTGAACGATCATTCAAGT Gene: Swoo_4056: Transcriptional regulator, TetR family	Transcriptional regulator, TetR family

CRON 2.
SO3392	* Shewanella oneidensis MR-1 Site: position = -34 score = 7.03966 sequence = TCTTGAACGTACATTCAAGA Site: position = -85 score = 5.53553 sequence = TATTGAACAAACATTCAAAA Site: position = -61 score = 5.75477 sequence = TCTTGAATGATCATTCAAAT Gene: SO_3392: NADH-dependent flavin oxidoreductase, Oye family	* Shewanella putrefaciens CN-32 Site: position = -34 score = 7.16778 sequence = TCTTGAATGCACATTCAAGA Site: position = -85 score = 5.53553 sequence = TTTTGAACAAACATTCAAAA Site: position = -61 score = 5.42819 sequence = ACTTGAATGTTCATTCAAAT Gene: Sputcn32_2720: NADH-dependent flavin oxidoreductase, Oye family	* Shewanella sp W3-18-1 Site: position = -34 score = 7.16778 sequence = TCTTGAATGCACATTCAAGA Site: position = -85 score = 5.53553 sequence = TTTTGAACAAACATTCAAAA Site: position = -61 score = 5.42819 sequence = ACTTGAATGTTCATTCAAAT Gene: Sputw3181_1292: NADH-dependent flavin oxidoreductase, Oye family	* Shewanella sp ANA-3 Site: position = -34 score = 7.16778 sequence = TCTTGAATGCACATTCAAGA Site: position = -85 score = 5.53553 sequence = TTTTGAACAAACATTCAAAA Site: position = -61 score = 5.53924 sequence = TCTTGAATGATCGTTCAAAT Gene: Shewana3_1159: NADH-dependent flavin oxidoreductase, Oye family	* Shewanella sp MR-4 Site: position = -34 score = 7.16778 sequence = TCTTGAATGCACATTCAAGA Site: position = -85 score = 5.53553 sequence = TTTTGAACAAACATTCAAAA Site: position = -61 score = 5.53924 sequence = TCTTGAATGATCGTTCAAAT Gene: Shewmr4_1158: NADH-dependent flavin oxidoreductase, Oye family	* Shewanella sp MR-7 Site: position = -34 score = 6.95225 sequence = TCTTGAATGCATATTCAAGA Site: position = -85 score = 5.53553 sequence = TTTTGAACAAACATTCAAAA Site: position = -61 score = 5.53924 sequence = TCTTGAATGATCGTTCAAAT Gene: Shewmr7_1229: NADH-dependent flavin oxidoreductase, Oye family	* Shewanella baltica OS155 Site: position = -34 score = 6.95225 sequence = TCTTGAATGCATATTCAAGA Site: position = -85 score = 5.96658 sequence = TTTTGAATGAACATTCAAAA Site: position = -61 score = 5.00085 sequence = ACTTGAATGATCGTTCAAAT Gene: Sbal_1249: NADH-dependent flavin oxidoreductase, Oye family	* Shewanella denitrificans OS217 Site: position = -32 score = 7.16778 sequence = TCTTGAATGCACATTCAAGA Site: position = -59 score = 4.99714 sequence = ACTTGAATGAATGTTCAAAT Gene: Sden_1230: NADH-dependent flavin oxidoreductase, Oye family	* Shewanella frigidimarina NCIMB 400 Site: position = -62 score = 5.55261 sequence = ACTTGAATGTGCATTCAATT Site: position = -34 score = 6.95225 sequence = TCTTGAATGCATATTCAAGA Gene: Sfri_1089: NADH-dependent flavin oxidoreductase, Oye family	* Shewanella amazonensis SB2B Site: position = -35 score = 5.21036 sequence = TTTTGAATGCCTGTTCAAAA Site: position = -62 score = 6.82413 sequence = TCTTGAATGTATGTTCAAGA Site: position = -86 score = 5.74735 sequence = TTTTGAATGTATGTTCAAAA Gene: Sama_2407: NADH-dependent flavin oxidoreductase, Oye family	* Shewanella loihica PV-4 Site: position = -33 score = 6.74044 sequence = TCTTGAACGCTCATTCAAGA Site: position = -84 score = 5.75106 sequence = TTTTGAATGAACGTTCAAAA Gene: Shew_3098: NADH-dependent flavin oxidoreductase, Oye family	Shewanella pealeana ATCC 700345	Shewanella halifaxensis HAW-EB4	* Shewanella piezotolerans WP3 Site: position = -33 score = 7.04337 sequence = TCTTGAATGTTCATTCAAGA Site: position = -60 score = 5.00085 sequence = ACTTGAATGATTATTCAAAT Site: position = -84 score = 5.53553 sequence = TTTTGAATGTTTGTTCAAAA Gene: swp_0975: NADH-dependent flavin oxidoreductase, Oye family	* Shewanella sediminis HAW-EB3 Site: position = -33 score = 7.04337 sequence = TCTTGAATGAACATTCAAGA Site: position = -84 score = 5.53553 sequence = TTTTGAATGTTTGTTCAAAA Site: position = -60 score = 5.00085 sequence = ACTTGAATGATCGTTCAAAT Gene: Ssed_3644: NADH-dependent flavin oxidoreductase, Oye family	* Shewanella woodyi ATCC 51908 Site: position = -33 score = 7.04337 sequence = TCTTGAATGAACATTCAAGA Site: position = -84 score = 5.53553 sequence = TTTTGAATGTTTGTTCAAAA Site: position = -60 score = 5.00085 sequence = ACTTGAATGATCGTTCAAAT Gene: Swoo_4055: NADH-dependent flavin oxidoreductase, Oye family	NADH-dependent flavin oxidoreductase, Oye family

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulog SO3393 - Shewanellaceae

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --