Regulon of SO3393 in Shewanella denitrificans OS217

Properties
Regulator type:	Transcription factor
TF locus tag:	Sden_1229
Regulator family:	TetR
Regulation mode:	repressor
Biological process:	Drug resistance
Effector:
Regulog:	SO3393 - Shewanellaceae
Statistics of regulated genes:
- Genes	2
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 78 sites [see more]

Member of regulog collections

By taxonomy - Shewanellaceae
By TF family - TetR
By pathway - Drug resistance

Regulated operons
	Locus Tag	Name	Function
Position: -59 Score: 5 Sequence: ACTTGAATGAATGTTCAAAT Position: -32 Score: 7.2 Sequence: TCTTGAATGCACATTCAAGA Locus tag: Sden_1230 Name: SO3392 Funciton: NADH-dependent flavin oxidoreductase, Oye family
	Sden_1230	SO3392	NADH-dependent flavin oxidoreductase, Oye family
Position: 14 Score: 7.2 Sequence: TCTTGAATGTGCATTCAAGA Position: 41 Score: 5 Sequence: ATTTGAACATTCATTCAAGT Locus tag: Sden_1229 Name: SO3393 Funciton: Transcriptional regulator, TetR family
	Sden_1229	SO3393	Transcriptional regulator, TetR family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD