Regulog RbsR - Shewanellaceae
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Ribose utilization |
| Effector: | Ribose |
| Phylum: | Proteobacteria/gamma |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Shewanellaceae
- By trascription factor - RbsR
- By TF family - LacI
- By effector - Ribose
- By pathway - Ribose utilization
| Genome | Genes | Operons |
|---|---|---|
| Shewanella oneidensis MR-1 | ||
| Shewanella putrefaciens CN-32 | ||
| Shewanella sp W3-18-1 | ||
| Shewanella sp ANA-3 | ||
| Shewanella sp MR-4 | ||
| Shewanella sp MR-7 | ||
| Shewanella baltica OS155 | ||
| Shewanella denitrificans OS217 | ||
| Shewanella frigidimarina NCIMB 400 | ||
| Shewanella amazonensis SB2B | ||
| Shewanella loihica PV-4 | ||
| Shewanella pealeana ATCC 700345 | 6 | 1 |
| Shewanella halifaxensis HAW-EB4 | 6 | 1 |
| Shewanella piezotolerans WP3 | ||
| Shewanella sediminis HAW-EB3 | ||
| Shewanella woodyi ATCC 51908 |
| Genes | Function | ||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||||||||||
| rbsD |
|
|
|
|
|
|
|
|
|
|
|
*
Shewanella pealeana ATCC 700345 Site: position = -93 score = 6.34657 sequence = TTATCGAAACGTTTCGATCG Site: position = -126 score = 6.20481 sequence = ATATCGAAACGTTTCGATTA Gene: Spea_0514: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1) |
*
Shewanella halifaxensis HAW-EB4 Site: position = -113 score = 6.20481 sequence = ATATCGAAACGTTTCGATTA Site: position = -80 score = 6.34657 sequence = TTATCGAAACGTTTCGATCG Gene: Shal_0578: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1) |
|
|
|
D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1) |
| rbsA |
|
|
|
|
|
|
|
|
|
|
|
Gene: Spea_0515: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1) |
Gene: Shal_0579: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1) |
|
|
|
Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1) |
| rbsC |
|
|
|
|
|
|
|
|
|
|
|
Gene: Spea_0516: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1) |
Gene: Shal_0580: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1) |
|
|
|
Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1) |
| rbsB |
|
|
|
|
|
|
|
|
|
|
|
Gene: Spea_0517: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1) |
Gene: Shal_0581: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1) |
|
|
|
Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1) |
| rbsK |
|
|
|
|
|
|
|
|
|
|
|
Gene: Spea_0518: Ribokinase (EC 2.7.1.15) |
Gene: Shal_0582: Ribokinase (EC 2.7.1.15) |
|
|
|
Ribokinase (EC 2.7.1.15) |
| rbsR |
|
|
|
|
|
|
|
|
|
|
|
Gene: Spea_0519: Transcriptional repressor of ribose utilization, LacI family |
Gene: Shal_0583: Transcriptional repressor of ribose utilization, LacI family |
|
|
|
Transcriptional repressor of ribose utilization, LacI family |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |