Regulog RbsR - Shewanellaceae

Properties
Regulator type:	Transcription factor
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Ribose utilization
Effector:	Ribose
Phylum:	Proteobacteria/gamma
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 4 sites [see more]

Member of regulog collections

By taxonomy - Shewanellaceae
By trascription factor - RbsR
By TF family - LacI
By effector - Ribose
By pathway - Ribose utilization

Statistics of regulated genes
Genome	Genes	Operons
Shewanella oneidensis MR-1
Shewanella putrefaciens CN-32
Shewanella sp W3-18-1
Shewanella sp ANA-3
Shewanella sp MR-4
Shewanella sp MR-7
Shewanella baltica OS155
Shewanella denitrificans OS217
Shewanella frigidimarina NCIMB 400
Shewanella amazonensis SB2B
Shewanella loihica PV-4
Shewanella pealeana ATCC 700345	6	1
Shewanella halifaxensis HAW-EB4	6	1
Shewanella piezotolerans WP3
Shewanella sediminis HAW-EB3
Shewanella woodyi ATCC 51908

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes																	Function

CRON 1.
rbsD	Shewanella oneidensis MR-1	Shewanella putrefaciens CN-32	Shewanella sp W3-18-1	Shewanella sp ANA-3	Shewanella sp MR-4	Shewanella sp MR-7	Shewanella baltica OS155	Shewanella denitrificans OS217	Shewanella frigidimarina NCIMB 400	Shewanella amazonensis SB2B	Shewanella loihica PV-4	* Shewanella pealeana ATCC 700345 Site: position = -93 score = 6.34657 sequence = TTATCGAAACGTTTCGATCG Site: position = -126 score = 6.20481 sequence = ATATCGAAACGTTTCGATTA Gene: Spea_0514: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)	* Shewanella halifaxensis HAW-EB4 Site: position = -113 score = 6.20481 sequence = ATATCGAAACGTTTCGATTA Site: position = -80 score = 6.34657 sequence = TTATCGAAACGTTTCGATCG Gene: Shal_0578: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)	Shewanella piezotolerans WP3	Shewanella sediminis HAW-EB3	Shewanella woodyi ATCC 51908	D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
rbsA	Shewanella oneidensis MR-1	Shewanella putrefaciens CN-32	Shewanella sp W3-18-1	Shewanella sp ANA-3	Shewanella sp MR-4	Shewanella sp MR-7	Shewanella baltica OS155	Shewanella denitrificans OS217	Shewanella frigidimarina NCIMB 400	Shewanella amazonensis SB2B	Shewanella loihica PV-4	Shewanella pealeana ATCC 700345 Gene: Spea_0515: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1)	Shewanella halifaxensis HAW-EB4 Gene: Shal_0579: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1)	Shewanella piezotolerans WP3	Shewanella sediminis HAW-EB3	Shewanella woodyi ATCC 51908	Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1)
rbsC	Shewanella oneidensis MR-1	Shewanella putrefaciens CN-32	Shewanella sp W3-18-1	Shewanella sp ANA-3	Shewanella sp MR-4	Shewanella sp MR-7	Shewanella baltica OS155	Shewanella denitrificans OS217	Shewanella frigidimarina NCIMB 400	Shewanella amazonensis SB2B	Shewanella loihica PV-4	Shewanella pealeana ATCC 700345 Gene: Spea_0516: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)	Shewanella halifaxensis HAW-EB4 Gene: Shal_0580: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)	Shewanella piezotolerans WP3	Shewanella sediminis HAW-EB3	Shewanella woodyi ATCC 51908	Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)
rbsB	Shewanella oneidensis MR-1	Shewanella putrefaciens CN-32	Shewanella sp W3-18-1	Shewanella sp ANA-3	Shewanella sp MR-4	Shewanella sp MR-7	Shewanella baltica OS155	Shewanella denitrificans OS217	Shewanella frigidimarina NCIMB 400	Shewanella amazonensis SB2B	Shewanella loihica PV-4	Shewanella pealeana ATCC 700345 Gene: Spea_0517: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1)	Shewanella halifaxensis HAW-EB4 Gene: Shal_0581: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1)	Shewanella piezotolerans WP3	Shewanella sediminis HAW-EB3	Shewanella woodyi ATCC 51908	Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1)
rbsK	Shewanella oneidensis MR-1	Shewanella putrefaciens CN-32	Shewanella sp W3-18-1	Shewanella sp ANA-3	Shewanella sp MR-4	Shewanella sp MR-7	Shewanella baltica OS155	Shewanella denitrificans OS217	Shewanella frigidimarina NCIMB 400	Shewanella amazonensis SB2B	Shewanella loihica PV-4	Shewanella pealeana ATCC 700345 Gene: Spea_0518: Ribokinase (EC 2.7.1.15)	Shewanella halifaxensis HAW-EB4 Gene: Shal_0582: Ribokinase (EC 2.7.1.15)	Shewanella piezotolerans WP3	Shewanella sediminis HAW-EB3	Shewanella woodyi ATCC 51908	Ribokinase (EC 2.7.1.15)
rbsR	Shewanella oneidensis MR-1	Shewanella putrefaciens CN-32	Shewanella sp W3-18-1	Shewanella sp ANA-3	Shewanella sp MR-4	Shewanella sp MR-7	Shewanella baltica OS155	Shewanella denitrificans OS217	Shewanella frigidimarina NCIMB 400	Shewanella amazonensis SB2B	Shewanella loihica PV-4	Shewanella pealeana ATCC 700345 Gene: Spea_0519: Transcriptional repressor of ribose utilization, LacI family	Shewanella halifaxensis HAW-EB4 Gene: Shal_0583: Transcriptional repressor of ribose utilization, LacI family	Shewanella piezotolerans WP3	Shewanella sediminis HAW-EB3	Shewanella woodyi ATCC 51908	Transcriptional repressor of ribose utilization, LacI family

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulog RbsR - Shewanellaceae

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --