Profile of regulator RbsR in Shewanellaceae

Properties
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Ribose utilization
Effector:	Ribose
Regulog:	RbsR - Shewanellaceae

Member of regulog collections

By taxonomy - Shewanellaceae
By trascription factor - RbsR
By TF family - LacI
By effector - Ribose
By pathway - Ribose utilization

Transcription factor binding sites

	Locus Tag	Name	Position	Score	Sequence
Shewanella pealeana ATCC 700345
	Spea_0514	rbsD	-93	6.3	TTATCGAAACGTTTCGATCG
	Spea_0514	rbsD	-126	6.2	ATATCGAAACGTTTCGATTA
Shewanella halifaxensis HAW-EB4
	Shal_0578	rbsD	-113	6.2	ATATCGAAACGTTTCGATTA
	Shal_0578	rbsD	-80	6.3	TTATCGAAACGTTTCGATCG

Export
	Regulatory Sites	[ FASTA format ]	DOWNLOAD