Regulog YhcF - Thermoanaerobacterales

Properties
Regulator type:	Transcription factor
Regulator family:	GntR/Others
Regulation mode:
Biological process:	Metabolite transport; Multidrug efflux; Multidrug resistance
Effector:
Phylum:	Firmicutes
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 3 sites [see more]

Member of regulog collections

By taxonomy - Thermoanaerobacterales
By TF family - GntR/Others
By pathway - Metabolite transport
By pathway - Multidrug efflux
By pathway - Multidrug resistance

Statistics of regulated genes
Genome	Genes	Operons
Anaerocellum thermophilum DSM 6725	6	1
Caldicellulosiruptor saccharolyticus DSM 8903	6	1
Carboxydothermus hydrogenoformans Z-2901
Moorella thermoacetica ATCC 39073	3	1
Thermoanaerobacter ethanolicus X514
Thermoanaerobacter italicus Ab9
Thermoanaerobacter tengcongensis MB4

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes								Function

CRON 1.
yhcF	* Anaerocellum thermophilum DSM 6725 Site: position = -42 score = 6.68084 sequence = AGTGTATTATTTAATTAGTACACC Gene: Athe_2352: Transcriptional regulator, GntR family	* Caldicellulosiruptor saccharolyticus DSM 8903 Site: position = -43 score = 6.75778 sequence = AGTGTATTATTTAATTAACACACT Gene: Csac_0140: Transcriptional regulator, GntR family	Carboxydothermus hydrogenoformans Z-2901	* Moorella thermoacetica ATCC 39073 Site: position = -56 score = 4.98509 sequence = AGTGCACTATTGCAATAGTGCACT Gene: Moth_1175: Transcriptional regulator, GntR family	Thermoanaerobacter ethanolicus X514	Thermoanaerobacter italicus Ab9	Thermoanaerobacter tengcongensis MB4	Transcriptional regulator, GntR family
yhcG	Anaerocellum thermophilum DSM 6725 Gene: Athe_2351: ABC-type multidrug transport system, ATPase component	Caldicellulosiruptor saccharolyticus DSM 8903 Gene: Csac_0141: ABC-type multidrug transport system, ATPase component	Carboxydothermus hydrogenoformans Z-2901	Moorella thermoacetica ATCC 39073 Gene: Moth_1174: ABC-type multidrug transport system, ATPase component	Thermoanaerobacter ethanolicus X514	Thermoanaerobacter italicus Ab9	Thermoanaerobacter tengcongensis MB4	ABC-type multidrug transport system, ATPase component
yhcI	Anaerocellum thermophilum DSM 6725 Gene: Athe_2350: ABC-type multidrug transport system, permease component	Caldicellulosiruptor saccharolyticus DSM 8903 Gene: Csac_0142: ABC-type multidrug transport system, permease component	Carboxydothermus hydrogenoformans Z-2901	Moorella thermoacetica ATCC 39073 Gene: Moth_1173: ABC-type multidrug transport system, permease component	Thermoanaerobacter ethanolicus X514	Thermoanaerobacter italicus Ab9	Thermoanaerobacter tengcongensis MB4	ABC-type multidrug transport system, permease component
yhcJ	Anaerocellum thermophilum DSM 6725 Gene: Athe_2349: Conserved membrane protein	Caldicellulosiruptor saccharolyticus DSM 8903 Gene: Csac_0143: Conserved membrane protein	Carboxydothermus hydrogenoformans Z-2901	Moorella thermoacetica ATCC 39073	Thermoanaerobacter ethanolicus X514	Thermoanaerobacter italicus Ab9	Thermoanaerobacter tengcongensis MB4	Conserved membrane protein
yhcH	Anaerocellum thermophilum DSM 6725 Gene: Athe_2348: ABC transporter, ATP-binding protein	Caldicellulosiruptor saccharolyticus DSM 8903 Gene: Csac_0144: ABC transporter, ATP-binding protein	Carboxydothermus hydrogenoformans Z-2901	Moorella thermoacetica ATCC 39073	Thermoanaerobacter ethanolicus X514	Thermoanaerobacter italicus Ab9	Thermoanaerobacter tengcongensis MB4	ABC transporter, ATP-binding protein
yhcK	Anaerocellum thermophilum DSM 6725 Gene: Athe_2347: Conserved membrane protein	Caldicellulosiruptor saccharolyticus DSM 8903 Gene: Csac_0145: Conserved membrane protein	Carboxydothermus hydrogenoformans Z-2901	Moorella thermoacetica ATCC 39073	Thermoanaerobacter ethanolicus X514	Thermoanaerobacter italicus Ab9	Thermoanaerobacter tengcongensis MB4	Conserved membrane protein

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulog YhcF - Thermoanaerobacterales

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --