Regulog YhcF - Thermoanaerobacterales
| Regulator type: | Transcription factor |
| Regulator family: | GntR/Others |
| Regulation mode: | |
| Biological process: | Metabolite transport; Multidrug efflux; Multidrug resistance |
| Effector: | |
| Phylum: | Firmicutes |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Thermoanaerobacterales
- By TF family - GntR/Others
- By pathway - Metabolite transport
- By pathway - Multidrug efflux
- By pathway - Multidrug resistance
| Genome | Genes | Operons |
|---|---|---|
| Anaerocellum thermophilum DSM 6725 | 6 | 1 |
| Caldicellulosiruptor saccharolyticus DSM 8903 | 6 | 1 |
| Carboxydothermus hydrogenoformans Z-2901 | ||
| Moorella thermoacetica ATCC 39073 | 3 | 1 |
| Thermoanaerobacter ethanolicus X514 | ||
| Thermoanaerobacter italicus Ab9 | ||
| Thermoanaerobacter tengcongensis MB4 |
| Genes | Function | |||||||
|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||
| yhcF |
*
Anaerocellum thermophilum DSM 6725 Site: position = -42 score = 6.68084 sequence = AGTGTATTATTTAATTAGTACACC Gene: Athe_2352: Transcriptional regulator, GntR family |
*
Caldicellulosiruptor saccharolyticus DSM 8903 Site: position = -43 score = 6.75778 sequence = AGTGTATTATTTAATTAACACACT Gene: Csac_0140: Transcriptional regulator, GntR family |
|
*
Moorella thermoacetica ATCC 39073 Site: position = -56 score = 4.98509 sequence = AGTGCACTATTGCAATAGTGCACT Gene: Moth_1175: Transcriptional regulator, GntR family |
|
|
|
Transcriptional regulator, GntR family |
| yhcG |
Gene: Athe_2351: ABC-type multidrug transport system, ATPase component |
Gene: Csac_0141: ABC-type multidrug transport system, ATPase component |
|
Gene: Moth_1174: ABC-type multidrug transport system, ATPase component |
|
|
|
ABC-type multidrug transport system, ATPase component |
| yhcI |
Gene: Athe_2350: ABC-type multidrug transport system, permease component |
Gene: Csac_0142: ABC-type multidrug transport system, permease component |
|
Gene: Moth_1173: ABC-type multidrug transport system, permease component |
|
|
|
ABC-type multidrug transport system, permease component |
| yhcJ |
Gene: Athe_2349: Conserved membrane protein |
Gene: Csac_0143: Conserved membrane protein |
|
|
|
|
|
Conserved membrane protein |
| yhcH |
Gene: Athe_2348: ABC transporter, ATP-binding protein |
Gene: Csac_0144: ABC transporter, ATP-binding protein |
|
|
|
|
|
ABC transporter, ATP-binding protein |
| yhcK |
Gene: Athe_2347: Conserved membrane protein |
Gene: Csac_0145: Conserved membrane protein |
|
|
|
|
|
Conserved membrane protein |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |