Regulon of YhcF in Anaerocellum thermophilum DSM 6725

Properties
Regulator type:	Transcription factor
TF locus tag:	Athe_2352
Regulator family:	GntR/Others
Regulation mode:
Biological process:	Metabolite transport; Multidrug efflux; Multidrug resistance
Effector:
Regulog:	YhcF - Thermoanaerobacterales
Statistics of regulated genes:
- Genes	6
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 3 sites [see more]

Member of regulog collections

By taxonomy - Thermoanaerobacterales
By TF family - GntR/Others
By pathway - Metabolite transport
By pathway - Multidrug efflux
By pathway - Multidrug resistance

Regulated operons
	Locus Tag	Name	Function
Position: -42 Score: 6.7 Sequence: AGTGTATTATTTAATTAGTACACC Locus tag: Athe_2352 Name: yhcF Funciton: Transcriptional regulator, GntR family Locus tag: Athe_2351 Name: yhcG Funciton: ABC-type multidrug transport system, ATPase component Locus tag: Athe_2350 Name: yhcI Funciton: ABC-type multidrug transport system, permease component Locus tag: Athe_2349 Name: yhcJ Funciton: Conserved membrane protein Locus tag: Athe_2348 Name: yhcH Funciton: ABC transporter, ATP-binding protein Locus tag: Athe_2347 Name: yhcK Funciton: Conserved membrane protein
	Athe_2352	yhcF	Transcriptional regulator, GntR family
	Athe_2351	yhcG	ABC-type multidrug transport system, ATPase component
	Athe_2350	yhcI	ABC-type multidrug transport system, permease component
	Athe_2349	yhcJ	Conserved membrane protein
	Athe_2348	yhcH	ABC transporter, ATP-binding protein
	Athe_2347	yhcK	Conserved membrane protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD