Regulon of YhcF in Caldicellulosiruptor saccharolyticus DSM 8903

Properties
Regulator type:	Transcription factor
TF locus tag:	Csac_0140
Regulator family:	GntR/Others
Regulation mode:
Biological process:	Metabolite transport; Multidrug efflux; Multidrug resistance
Effector:
Regulog:	YhcF - Thermoanaerobacterales
Statistics of regulated genes:
- Genes	6
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 3 sites [see more]

Member of regulog collections

By taxonomy - Thermoanaerobacterales
By TF family - GntR/Others
By pathway - Metabolite transport
By pathway - Multidrug efflux
By pathway - Multidrug resistance

Regulated operons
	Locus Tag	Name	Function
Position: -43 Score: 6.8 Sequence: AGTGTATTATTTAATTAACACACT Locus tag: Csac_0140 Name: yhcF Funciton: Transcriptional regulator, GntR family Locus tag: Csac_0141 Name: yhcG Funciton: ABC-type multidrug transport system, ATPase component Locus tag: Csac_0142 Name: yhcI Funciton: ABC-type multidrug transport system, permease component Locus tag: Csac_0143 Name: yhcJ Funciton: Conserved membrane protein Locus tag: Csac_0144 Name: yhcH Funciton: ABC transporter, ATP-binding protein Locus tag: Csac_0145 Name: yhcK Funciton: Conserved membrane protein
	Csac_0140	yhcF	Transcriptional regulator, GntR family
	Csac_0141	yhcG	ABC-type multidrug transport system, ATPase component
	Csac_0142	yhcI	ABC-type multidrug transport system, permease component
	Csac_0143	yhcJ	Conserved membrane protein
	Csac_0144	yhcH	ABC transporter, ATP-binding protein
	Csac_0145	yhcK	Conserved membrane protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD