Regulon of YhcF in Moorella thermoacetica ATCC 39073

Properties
Regulator type:	Transcription factor
TF locus tag:	Moth_1175
Regulator family:	GntR/Others
Regulation mode:
Biological process:	Metabolite transport; Multidrug efflux; Multidrug resistance
Effector:
Regulog:	YhcF - Thermoanaerobacterales
Statistics of regulated genes:
- Genes	3
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 3 sites [see more]

Member of regulog collections

By taxonomy - Thermoanaerobacterales
By TF family - GntR/Others
By pathway - Metabolite transport
By pathway - Multidrug efflux
By pathway - Multidrug resistance

Regulated operons
	Locus Tag	Name	Function
Position: -56 Score: 5 Sequence: AGTGCACTATTGCAATAGTGCACT Locus tag: Moth_1175 Name: yhcF Funciton: Transcriptional regulator, GntR family Locus tag: Moth_1174 Name: yhcG Funciton: ABC-type multidrug transport system, ATPase component Locus tag: Moth_1173 Name: yhcI Funciton: ABC-type multidrug transport system, permease component
	Moth_1175	yhcF	Transcriptional regulator, GntR family
	Moth_1174	yhcG	ABC-type multidrug transport system, ATPase component
	Moth_1173	yhcI	ABC-type multidrug transport system, permease component

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD