Regulog LexA - Listeriaceae

Member of regulog collections
- By trascription factor - LexA
- By taxonomy - Listeriaceae
- By TF family - LexA
- By effector - DNA damage
- By pathway - SOS response
Genome | Genes | Operons |
---|---|---|
Listeria innocua Clip11262 | 25 | 12 |
Listeria monocytogenes EGD-e | 25 | 12 |
Listeria seeligeri serovar 1/2b str. SLCC3954 | 22 | 10 |
Listeria welshimeri serovar 6b str. SLCC5334 | 22 | 10 |
Genes | Function | ||||
---|---|---|---|---|---|
CRON 1. | |||||
uvrB |
*
Listeria innocua Clip11262 Site: position = -163 score = 6.10283 sequence = GAATACGAAAATATGTTCGGTTTT Gene: lin2632: Excinuclease ABC, subunit B |
*
Listeria monocytogenes EGD-e Site: position = -165 score = 6.2522 sequence = AAATGCGAAAATATGTTCGGTTTT Gene: lmo2489: Excinuclease ABC, subunit B |
*
Listeria seeligeri serovar 1/2b str. SLCC3954 Site: position = -165 score = 6.43366 sequence = AAATACGAAAATATGTTCGGTTTT Gene: lse_2389: Excinuclease ABC, subunit B |
*
Listeria welshimeri serovar 6b str. SLCC5334 Site: position = -166 score = 6.43366 sequence = AAATACGAAAATATGTTCGGTTTT Gene: lwe2437: Excinuclease ABC, subunit B |
Excinuclease ABC, subunit B |
uvrA |
Gene: lin2631: Excinuclease ABC, subunit A |
Gene: lmo2488: Excinuclease ABC, subunit A |
Gene: lse_2388: Excinuclease ABC, subunit A |
Gene: lwe2436: Excinuclease ABC, subunit A |
Excinuclease ABC, subunit A |
CRON 2. | |||||
recA |
*
Listeria innocua Clip11262 Site: position = -142 score = 6.30014 sequence = AAATACGAATAAATGTTCGCTTTT Gene: lin1435: DNA recombinase A |
*
Listeria monocytogenes EGD-e Site: position = -142 score = 6.30014 sequence = AAATACGAATAAATGTTCGCTTTT Gene: lmo1398: DNA recombinase A |
*
Listeria seeligeri serovar 1/2b str. SLCC3954 Site: position = -143 score = 6.30014 sequence = AAATACGAATAAATGTTCGCTTTT Gene: lse_1315: DNA recombinase A |
*
Listeria welshimeri serovar 6b str. SLCC5334 Site: position = -143 score = 6.30014 sequence = AAATACGAATAAATGTTCGCTTTT Gene: lwe1414: DNA recombinase A |
DNA recombinase A |
CRON 3. | |||||
lexA |
*
Listeria innocua Clip11262 Site: position = -144 score = 6.0385 sequence = AAAAAAGAATGTACGTTCGCTTTT Site: position = -84 score = 5.60417 sequence = AAAAACGAACCTTTGTTTGCATAT Gene: lin1340: SOS-response repressor and protease LexA (EC 3.4.21.88) |
*
Listeria monocytogenes EGD-e Site: position = -144 score = 5.91372 sequence = CAAAAAGAATGTATGTTCGCTTTT Site: position = -84 score = 5.60417 sequence = AAAAACGAACCTTTGTTTGCATAT Gene: lmo1302: SOS-response repressor and protease LexA (EC 3.4.21.88) |
*
Listeria seeligeri serovar 1/2b str. SLCC3954 Site: position = -83 score = 5.60417 sequence = AAAAACGAACCTTTGTTTGCATAT Site: position = -142 score = 5.67401 sequence = CCAAAAGAATGTATGTTCGCTTTT Gene: lse_1219: SOS-response repressor and protease LexA (EC 3.4.21.88) |
*
Listeria welshimeri serovar 6b str. SLCC5334 Site: position = -84 score = 5.60417 sequence = AAAAACGAACCTTTGTTTGCATAT Site: position = -146 score = 5.91372 sequence = CAAAAAGAATGTATGTTCGCTTTT Gene: lwe1317: SOS-response repressor and protease LexA (EC 3.4.21.88) |
SOS-response repressor and protease LexA (EC 3.4.21.88) |
guaA |
Gene: lin1339: Probable GMP synthase |
Gene: lmo1301: Probable GMP synthase |
Gene: lse_1218: Probable GMP synthase |
Gene: lwe1316: Probable GMP synthase |
Probable GMP synthase |
CRON 4. | |||||
yhaO |
*
Listeria innocua Clip11262 Site: position = -42 score = 5.89468 sequence = TAATAAGAACGTATATTCGGTTTT Gene: lin2325: Predicted DNA double-strand break repair protein |
*
Listeria monocytogenes EGD-e Site: position = -41 score = 5.89468 sequence = TAATAAGAACGTATATTCGGTTTT Gene: lmo2222: Predicted DNA double-strand break repair protein |
*
Listeria seeligeri serovar 1/2b str. SLCC3954 Site: position = -44 score = 5.89468 sequence = TAATAAGAACGTATATTCGGTTTT Gene: lse_2202: Predicted DNA double-strand break repair protein |
*
Listeria welshimeri serovar 6b str. SLCC5334 Site: position = -39 score = 5.89468 sequence = TAATAAGAACGTATATTCGGTTTT Gene: lwe2239: Predicted DNA double-strand break repair protein |
Predicted DNA double-strand break repair protein |
yhaN |
Gene: lin2324: Putative DNA double-strand break repair ATPase |
Gene: lmo2221: Putative DNA double-strand break repair ATPase |
Gene: lse_2201: Putative DNA double-strand break repair ATPase |
Gene: lwe2238: Putative DNA double-strand break repair ATPase |
Putative DNA double-strand break repair ATPase |
yhaM |
Gene: lin2323: Predicted 3'-5' exoribonuclease |
Gene: lmo2220: Predicted 3'-5' exoribonuclease |
Gene: lse_2200: Predicted 3'-5' exoribonuclease |
Gene: lwe2237: Predicted 3'-5' exoribonuclease |
Predicted 3'-5' exoribonuclease |
CRON 5. | |||||
pcrA |
*
Listeria innocua Clip11262 Site: position = -44 score = 5.83983 sequence = AAATAAGAACAAATGTTTGTATGG Gene: lin1871: ATP-dependent DNA helicase UvrD/PcrA |
*
Listeria monocytogenes EGD-e Site: position = -44 score = 5.83983 sequence = AAATAAGAACAAATGTTTGTATGG Gene: lmo1759: ATP-dependent DNA helicase UvrD/PcrA |
*
Listeria seeligeri serovar 1/2b str. SLCC3954 Site: position = -44 score = 5.83983 sequence = AAATAAGAACAAATGTTTGTATGG Gene: lse_1731: ATP-dependent DNA helicase UvrD/PcrA |
*
Listeria welshimeri serovar 6b str. SLCC5334 Site: position = -38 score = 5.83983 sequence = AAATAAGAACAAATGTTTGTATGG Gene: lwe1776: ATP-dependent DNA helicase UvrD/PcrA |
ATP-dependent DNA helicase UvrD/PcrA |
ligA |
Gene: lin1870: DNA ligase (EC 6.5.1.2) |
Gene: lmo1758: DNA ligase (EC 6.5.1.2) |
Gene: lse_1730: DNA ligase (EC 6.5.1.2) |
Gene: lwe1775: DNA ligase (EC 6.5.1.2) |
DNA ligase (EC 6.5.1.2) |
yerH |
Gene: lin1869: Putative lipoprotein |
Gene: lmo1757: Putative lipoprotein |
Gene: lse_1729: Putative lipoprotein |
Gene: lwe1774: Putative lipoprotein |
Putative lipoprotein |
CRON 6. | |||||
dnaE |
*
Listeria innocua Clip11262 Site: position = -75 score = 5.63719 sequence = AAACGCGAACACACTTTCTTTTTT Gene: lin1609: DNA polymerase III alpha subunit (EC 2.7.7.7) |
*
Listeria monocytogenes EGD-e Site: position = -75 score = 5.81865 sequence = AAACACGAACACACTTTCTTTTTT Gene: lmo1574: DNA polymerase III alpha subunit (EC 2.7.7.7) |
*
Listeria seeligeri serovar 1/2b str. SLCC3954 Site: position = -75 score = 5.81865 sequence = AAACACGAACACACTTTCTTTTTT Gene: lse_1489: DNA polymerase III alpha subunit (EC 2.7.7.7) |
*
Listeria welshimeri serovar 6b str. SLCC5334 Site: position = -75 score = 5.81865 sequence = AAACACGAACACACTTTCTTTTTT Gene: lwe1587: DNA polymerase III alpha subunit (EC 2.7.7.7) |
DNA polymerase III alpha subunit (EC 2.7.7.7) |
CRON 7. | |||||
addB |
*
Listeria innocua Clip11262 Site: position = -30 score = 5.75957 sequence = AAATAAAAACATATGTTCGGTGGT Gene: lin2369: ATP-dependent nuclease, subunit B |
*
Listeria monocytogenes EGD-e Site: position = -30 score = 5.75957 sequence = AAATAAAAACATATGTTCGGTGGT Gene: lmo2268: ATP-dependent nuclease, subunit B |
*
Listeria seeligeri serovar 1/2b str. SLCC3954 Site: position = -30 score = 5.60011 sequence = AAATAAAAACGTATGTTCGGTGGT Gene: lse_2247: ATP-dependent nuclease, subunit B |
*
Listeria welshimeri serovar 6b str. SLCC5334 Site: position = -30 score = 5.75957 sequence = AAATAAAAACATATGTTCGGTGGT Gene: lwe2283: ATP-dependent nuclease, subunit B |
ATP-dependent nuclease, subunit B |
addA |
Gene: lin2368: ATP-dependent nuclease, subunit A |
Gene: lmo2267: ATP-dependent nuclease, subunit A |
Gene: lse_2246: ATP-dependent nuclease, subunit A |
Gene: lwe2282: ATP-dependent nuclease, subunit A |
ATP-dependent nuclease, subunit A |
yisK |
Gene: lin2367: Conserved hypothetical protein |
Gene: lmo2266: Conserved hypothetical protein |
Gene: lse_2245: Conserved hypothetical protein |
Gene: lwe2281: Conserved hypothetical protein |
Conserved hypothetical protein |
PF07457 |
Gene: lin2366: Conserved hypothetical protein |
Gene: lmo2265: Conserved hypothetical protein |
Gene: lse_2244: Conserved hypothetical protein |
Gene: lwe2280: Conserved hypothetical protein |
Conserved hypothetical protein |
CRON 8. | |||||
lmo2675 |
*
Listeria innocua Clip11262 Site: position = -73 score = 5.52472 sequence = AAACAAGAACGTTTGTTCGTATAA Gene: lin2822: Conserved hypothetical protein |
*
Listeria monocytogenes EGD-e Site: position = -72 score = 5.63547 sequence = TAATAAGAACATTTGTTCGTATAA Gene: lmo2675: Conserved hypothetical protein |
*
Listeria seeligeri serovar 1/2b str. SLCC3954 Site: position = -72 score = 5.24049 sequence = CAACAAGAACATTCGTTCGTATAA Gene: lse_2581: Conserved hypothetical protein |
*
Listeria welshimeri serovar 6b str. SLCC5334 Site: position = -72 score = 5.09735 sequence = AAAATAGAACGCTTGTTCGTATAA Gene: lwe2624: Conserved hypothetical protein |
Conserved hypothetical protein |
uvrX |
Gene: lin2823: Predicted UV-damage repair protein UvrX |
Gene: lmo2676: Predicted UV-damage repair protein UvrX |
Gene: lse_2582: Predicted UV-damage repair protein UvrX |
Gene: lwe2625: Predicted UV-damage repair protein UvrX |
Predicted UV-damage repair protein UvrX |
CRON 9. | |||||
dinP |
*
Listeria innocua Clip11262 Site: position = -38 score = 5.52928 sequence = GAATAAGAACGCTTGTTCGTTTTA Gene: lin2082: DNA polymerase IV (EC 2.7.7.7) |
*
Listeria monocytogenes EGD-e Site: position = -38 score = 5.5507 sequence = GAATAAGAACGCTTGTTCGTTTTG Gene: lmo1975: DNA polymerase IV (EC 2.7.7.7) |
*
Listeria seeligeri serovar 1/2b str. SLCC3954 Site: position = -39 score = 5.51056 sequence = ATTAAGGAACATTTGTTCGTTTTT Gene: lse_1955: DNA polymerase IV (EC 2.7.7.7) |
*
Listeria welshimeri serovar 6b str. SLCC5334 Site: position = -41 score = 5.25201 sequence = GATTAAGAACGTTTGTTCGATTTT Gene: lwe1994: DNA polymerase IV (EC 2.7.7.7) |
DNA polymerase IV (EC 2.7.7.7) |
CRON 10. | |||||
srmB |
*
Listeria innocua Clip11262 Site: position = -57 score = 4.67387 sequence = TGATGCGAACGTAGGTTCTGTGTT Gene: lin0195: DinG family ATP-dependent helicase CPE1197 |
*
Listeria monocytogenes EGD-e Site: position = -57 score = 4.25077 sequence = TGTTGCGAACGTAGGTTCTGTGTT Gene: lmo0157: DinG family ATP-dependent helicase CPE1197 |
Gene: lse_0136: DinG family ATP-dependent helicase CPE1197 |
Gene: lwe0133: DinG family ATP-dependent helicase CPE1197 |
DinG family ATP-dependent helicase CPE1197 |
yxeH |
Gene: lin0196: Cof-like hydrolase |
Gene: lmo0158: Cof-like hydrolase |
Gene: lse_0137: Cof-like hydrolase |
Gene: lwe0134: Cof-like hydrolase |
Cof-like hydrolase |
CRON 11. | |||||
lin1681 |
*
Listeria innocua Clip11262 Site: position = -47 score = 4.64164 sequence = AAAAGGGAACGTATGTTTTATGAT Gene: lin1681: Conserved hypothetical protein |
*
Listeria monocytogenes EGD-e Site: position = -47 score = 4.93443 sequence = AAAACAGAACATATGTTTTATCAT Gene: lmo1640: Conserved hypothetical protein |
*
Listeria seeligeri serovar 1/2b str. SLCC3954 Site: position = -47 score = 4.72754 sequence = AAAATAGAACGTATGTTTTATGAT Gene: lse_1561: Conserved hypothetical protein |
*
Listeria welshimeri serovar 6b str. SLCC5334 Site: position = -47 score = 5.14336 sequence = AAAACAGAACATATGTTTTATGAT Gene: lwe1656: Conserved hypothetical protein |
Conserved hypothetical protein |
tag |
Gene: lin1680: DNA-3-methyladenine glycosylase (EC 3.2.2.20) |
Gene: lmo1639: DNA-3-methyladenine glycosylase (EC 3.2.2.20) |
Gene: lse_1560: DNA-3-methyladenine glycosylase (EC 3.2.2.20) |
Gene: lwe1655: DNA-3-methyladenine glycosylase (EC 3.2.2.20) |
DNA-3-methyladenine glycosylase (EC 3.2.2.20) |
lin1679 |
Gene: lin1679: Putative carboxypeptidase |
Gene: lmo1638: Putative carboxypeptidase |
Gene: lse_1559: Putative carboxypeptidase |
Gene: lwe1654: Putative carboxypeptidase |
Putative carboxypeptidase |
CRON 12. | |||||
int |
*
Listeria innocua Clip11262 Site: position = -33 score = 4.63328 sequence = AAAAAAGAACGTATGTGCGAAAGG Gene: lin2426: Integrase |
*
Listeria monocytogenes EGD-e Site: position = -33 score = 4.63328 sequence = AAAAAAGAACGTATGTGCGAAAGG Gene: lmo2332: Integrase |
|
|
Integrase |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
![]() |
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
![]() |
Regulatory Sites | [ FASTA format ] | DOWNLOAD |