Regulon of LexA in Listeria monocytogenes EGD-e

Properties
Regulator type:	Transcription factor
TF locus tag:	lmo1302
Regulator family:	LexA
Regulation mode:	repressor
Biological process:	SOS response
Effector:	DNA damage
Regulog:	LexA - Listeriaceae
Statistics of regulated genes:
- Genes	25
- Operons	12
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 48 sites [see more]

Member of regulog collections

By trascription factor - LexA
By taxonomy - Listeriaceae
By TF family - LexA
By effector - DNA damage
By pathway - SOS response

Regulated operons
	Locus Tag	Name	Function
Position: -41 Score: 5.9 Sequence: TAATAAGAACGTATATTCGGTTTT Locus tag: lmo2222 Name: yhaO Funciton: Predicted DNA double-strand break repair protein Locus tag: lmo2221 Name: yhaN Funciton: Putative DNA double-strand break repair ATPase Locus tag: lmo2220 Name: yhaM Funciton: Predicted 3'-5' exoribonuclease
	lmo2222	yhaO	Predicted DNA double-strand break repair protein
	lmo2221	yhaN	Putative DNA double-strand break repair ATPase
	lmo2220	yhaM	Predicted 3'-5' exoribonuclease
Position: -57 Score: 4.3 Sequence: TGTTGCGAACGTAGGTTCTGTGTT Locus tag: lmo0157 Name: srmB Funciton: DinG family ATP-dependent helicase CPE1197 Locus tag: lmo0158 Name: yxeH Funciton: Cof-like hydrolase
	lmo0157	srmB	DinG family ATP-dependent helicase CPE1197
	lmo0158	yxeH	Cof-like hydrolase
Position: -47 Score: 4.9 Sequence: AAAACAGAACATATGTTTTATCAT Locus tag: lmo1640 Name: lin1681 Funciton: Conserved hypothetical protein Locus tag: lmo1639 Name: tag Funciton: DNA-3-methyladenine glycosylase (EC 3.2.2.20) Locus tag: lmo1638 Name: lin1679 Funciton: Putative carboxypeptidase
	lmo1640	lin1681	Conserved hypothetical protein
	lmo1639	tag	DNA-3-methyladenine glycosylase (EC 3.2.2.20)
	lmo1638	lin1679	Putative carboxypeptidase
Position: -72 Score: 5.6 Sequence: TAATAAGAACATTTGTTCGTATAA Locus tag: lmo2675 Name: lmo2675 Funciton: Conserved hypothetical protein Locus tag: lmo2676 Name: uvrX Funciton: Predicted UV-damage repair protein UvrX
	lmo2675	lmo2675	Conserved hypothetical protein
	lmo2676	uvrX	Predicted UV-damage repair protein UvrX
Position: -165 Score: 6.3 Sequence: AAATGCGAAAATATGTTCGGTTTT Locus tag: lmo2489 Name: uvrB Funciton: Excinuclease ABC, subunit B Locus tag: lmo2488 Name: uvrA Funciton: Excinuclease ABC, subunit A
	lmo2489	uvrB	Excinuclease ABC, subunit B
	lmo2488	uvrA	Excinuclease ABC, subunit A
Position: -142 Score: 6.3 Sequence: AAATACGAATAAATGTTCGCTTTT Locus tag: lmo1398 Name: recA Funciton: DNA recombinase A
	lmo1398	recA	DNA recombinase A
Position: -144 Score: 5.9 Sequence: CAAAAAGAATGTATGTTCGCTTTT Position: -84 Score: 5.6 Sequence: AAAAACGAACCTTTGTTTGCATAT Locus tag: lmo1302 Name: lexA Funciton: SOS-response repressor and protease LexA (EC 3.4.21.88) Locus tag: lmo1301 Name: guaA Funciton: Probable GMP synthase
	lmo1302	lexA	SOS-response repressor and protease LexA (EC 3.4.21.88)
	lmo1301	guaA	Probable GMP synthase
Position: -30 Score: 5.8 Sequence: AAATAAAAACATATGTTCGGTGGT Locus tag: lmo2268 Name: addB Funciton: ATP-dependent nuclease, subunit B Locus tag: lmo2267 Name: addA Funciton: ATP-dependent nuclease, subunit A Locus tag: lmo2266 Name: yisK Funciton: Conserved hypothetical protein Locus tag: lmo2265 Name: PF07457 Funciton: Conserved hypothetical protein
	lmo2268	addB	ATP-dependent nuclease, subunit B
	lmo2267	addA	ATP-dependent nuclease, subunit A
	lmo2266	yisK	Conserved hypothetical protein
	lmo2265	PF07457	Conserved hypothetical protein
Position: -33 Score: 4.6 Sequence: AAAAAAGAACGTATGTGCGAAAGG Locus tag: lmo2332 Name: int Funciton: Integrase
	lmo2332	int	Integrase
Position: -38 Score: 5.6 Sequence: GAATAAGAACGCTTGTTCGTTTTG Locus tag: lmo1975 Name: dinP Funciton: DNA polymerase IV (EC 2.7.7.7)
	lmo1975	dinP	DNA polymerase IV (EC 2.7.7.7)
Position: -44 Score: 5.8 Sequence: AAATAAGAACAAATGTTTGTATGG Locus tag: lmo1759 Name: pcrA Funciton: ATP-dependent DNA helicase UvrD/PcrA Locus tag: lmo1758 Name: ligA Funciton: DNA ligase (EC 6.5.1.2) Locus tag: lmo1757 Name: yerH Funciton: Putative lipoprotein
	lmo1759	pcrA	ATP-dependent DNA helicase UvrD/PcrA
	lmo1758	ligA	DNA ligase (EC 6.5.1.2)
	lmo1757	yerH	Putative lipoprotein
Position: -75 Score: 5.8 Sequence: AAACACGAACACACTTTCTTTTTT Locus tag: lmo1574 Name: dnaE Funciton: DNA polymerase III alpha subunit (EC 2.7.7.7)
	lmo1574	dnaE	DNA polymerase III alpha subunit (EC 2.7.7.7)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulon of LexA in Listeria monocytogenes EGD-e

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --