Regulon of LexA in Listeria seeligeri serovar 1/2b str. SLCC3954

Properties
Regulator type:	Transcription factor
TF locus tag:	lse_1219
Regulator family:	LexA
Regulation mode:	repressor
Biological process:	SOS response
Effector:	DNA damage
Regulog:	LexA - Listeriaceae
Statistics of regulated genes:
- Genes	22
- Operons	10
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 48 sites [see more]

Member of regulog collections

By trascription factor - LexA
By taxonomy - Listeriaceae
By TF family - LexA
By effector - DNA damage
By pathway - SOS response

Regulated operons
	Locus Tag	Name	Function
Position: -39 Score: 5.5 Sequence: ATTAAGGAACATTTGTTCGTTTTT Locus tag: lse_1955 Name: dinP Funciton: DNA polymerase IV (EC 2.7.7.7)
	lse_1955	dinP	DNA polymerase IV (EC 2.7.7.7)
Position: -165 Score: 6.4 Sequence: AAATACGAAAATATGTTCGGTTTT Locus tag: lse_2389 Name: uvrB Funciton: Excinuclease ABC, subunit B Locus tag: lse_2388 Name: uvrA Funciton: Excinuclease ABC, subunit A
	lse_2389	uvrB	Excinuclease ABC, subunit B
	lse_2388	uvrA	Excinuclease ABC, subunit A
Position: -44 Score: 5.8 Sequence: AAATAAGAACAAATGTTTGTATGG Locus tag: lse_1731 Name: pcrA Funciton: ATP-dependent DNA helicase UvrD/PcrA Locus tag: lse_1730 Name: ligA Funciton: DNA ligase (EC 6.5.1.2) Locus tag: lse_1729 Name: yerH Funciton: Putative lipoprotein
	lse_1731	pcrA	ATP-dependent DNA helicase UvrD/PcrA
	lse_1730	ligA	DNA ligase (EC 6.5.1.2)
	lse_1729	yerH	Putative lipoprotein
Position: -30 Score: 5.6 Sequence: AAATAAAAACGTATGTTCGGTGGT Locus tag: lse_2247 Name: addB Funciton: ATP-dependent nuclease, subunit B Locus tag: lse_2246 Name: addA Funciton: ATP-dependent nuclease, subunit A Locus tag: lse_2245 Name: yisK Funciton: Conserved hypothetical protein Locus tag: lse_2244 Name: PF07457 Funciton: Conserved hypothetical protein
	lse_2247	addB	ATP-dependent nuclease, subunit B
	lse_2246	addA	ATP-dependent nuclease, subunit A
	lse_2245	yisK	Conserved hypothetical protein
	lse_2244	PF07457	Conserved hypothetical protein
Position: -142 Score: 5.7 Sequence: CCAAAAGAATGTATGTTCGCTTTT Position: -83 Score: 5.6 Sequence: AAAAACGAACCTTTGTTTGCATAT Locus tag: lse_1219 Name: lexA Funciton: SOS-response repressor and protease LexA (EC 3.4.21.88) Locus tag: lse_1218 Name: guaA Funciton: Probable GMP synthase
	lse_1219	lexA	SOS-response repressor and protease LexA (EC 3.4.21.88)
	lse_1218	guaA	Probable GMP synthase
Position: -143 Score: 6.3 Sequence: AAATACGAATAAATGTTCGCTTTT Locus tag: lse_1315 Name: recA Funciton: DNA recombinase A
	lse_1315	recA	DNA recombinase A
Position: -75 Score: 5.8 Sequence: AAACACGAACACACTTTCTTTTTT Locus tag: lse_1489 Name: dnaE Funciton: DNA polymerase III alpha subunit (EC 2.7.7.7)
	lse_1489	dnaE	DNA polymerase III alpha subunit (EC 2.7.7.7)
Position: -47 Score: 4.7 Sequence: AAAATAGAACGTATGTTTTATGAT Locus tag: lse_1561 Name: lin1681 Funciton: Conserved hypothetical protein Locus tag: lse_1560 Name: tag Funciton: DNA-3-methyladenine glycosylase (EC 3.2.2.20) Locus tag: lse_1559 Name: lin1679 Funciton: Putative carboxypeptidase
	lse_1561	lin1681	Conserved hypothetical protein
	lse_1560	tag	DNA-3-methyladenine glycosylase (EC 3.2.2.20)
	lse_1559	lin1679	Putative carboxypeptidase
Position: -72 Score: 5.2 Sequence: CAACAAGAACATTCGTTCGTATAA Locus tag: lse_2581 Name: lmo2675 Funciton: Conserved hypothetical protein Locus tag: lse_2582 Name: uvrX Funciton: Predicted UV-damage repair protein UvrX
	lse_2581	lmo2675	Conserved hypothetical protein
	lse_2582	uvrX	Predicted UV-damage repair protein UvrX
Position: -44 Score: 5.9 Sequence: TAATAAGAACGTATATTCGGTTTT Locus tag: lse_2202 Name: yhaO Funciton: Predicted DNA double-strand break repair protein Locus tag: lse_2201 Name: yhaN Funciton: Putative DNA double-strand break repair ATPase Locus tag: lse_2200 Name: yhaM Funciton: Predicted 3'-5' exoribonuclease
	lse_2202	yhaO	Predicted DNA double-strand break repair protein
	lse_2201	yhaN	Putative DNA double-strand break repair ATPase
	lse_2200	yhaM	Predicted 3'-5' exoribonuclease

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulon of LexA in Listeria seeligeri serovar 1/2b str. SLCC3954

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --