Regulon of LexA in Listeria innocua Clip11262

Properties
Regulator type:	Transcription factor
TF locus tag:	lin1340
Regulator family:	LexA
Regulation mode:	repressor
Biological process:	SOS response
Effector:	DNA damage
Regulog:	LexA - Listeriaceae
Statistics of regulated genes:
- Genes	25
- Operons	12
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 48 sites [see more]

Member of regulog collections

By trascription factor - LexA
By taxonomy - Listeriaceae
By TF family - LexA
By effector - DNA damage
By pathway - SOS response

Regulated operons
	Locus Tag	Name	Function
Position: -57 Score: 4.7 Sequence: TGATGCGAACGTAGGTTCTGTGTT Locus tag: lin0195 Name: srmB Funciton: DinG family ATP-dependent helicase CPE1197 Locus tag: lin0196 Name: yxeH Funciton: Cof-like hydrolase
	lin0195	srmB	DinG family ATP-dependent helicase CPE1197
	lin0196	yxeH	Cof-like hydrolase
Position: -47 Score: 4.6 Sequence: AAAAGGGAACGTATGTTTTATGAT Locus tag: lin1681 Name: lin1681 Funciton: Conserved hypothetical protein Locus tag: lin1680 Name: tag Funciton: DNA-3-methyladenine glycosylase (EC 3.2.2.20) Locus tag: lin1679 Name: lin1679 Funciton: Putative carboxypeptidase
	lin1681	lin1681	Conserved hypothetical protein
	lin1680	tag	DNA-3-methyladenine glycosylase (EC 3.2.2.20)
	lin1679	lin1679	Putative carboxypeptidase
Position: -73 Score: 5.5 Sequence: AAACAAGAACGTTTGTTCGTATAA Locus tag: lin2822 Name: lmo2675 Funciton: Conserved hypothetical protein Locus tag: lin2823 Name: uvrX Funciton: Predicted UV-damage repair protein UvrX
	lin2822	lmo2675	Conserved hypothetical protein
	lin2823	uvrX	Predicted UV-damage repair protein UvrX
Position: -163 Score: 6.1 Sequence: GAATACGAAAATATGTTCGGTTTT Locus tag: lin2632 Name: uvrB Funciton: Excinuclease ABC, subunit B Locus tag: lin2631 Name: uvrA Funciton: Excinuclease ABC, subunit A
	lin2632	uvrB	Excinuclease ABC, subunit B
	lin2631	uvrA	Excinuclease ABC, subunit A
Position: -142 Score: 6.3 Sequence: AAATACGAATAAATGTTCGCTTTT Locus tag: lin1435 Name: recA Funciton: DNA recombinase A
	lin1435	recA	DNA recombinase A
Position: -144 Score: 6 Sequence: AAAAAAGAATGTACGTTCGCTTTT Position: -84 Score: 5.6 Sequence: AAAAACGAACCTTTGTTTGCATAT Locus tag: lin1340 Name: lexA Funciton: SOS-response repressor and protease LexA (EC 3.4.21.88) Locus tag: lin1339 Name: guaA Funciton: Probable GMP synthase
	lin1340	lexA	SOS-response repressor and protease LexA (EC 3.4.21.88)
	lin1339	guaA	Probable GMP synthase
Position: -30 Score: 5.8 Sequence: AAATAAAAACATATGTTCGGTGGT Locus tag: lin2369 Name: addB Funciton: ATP-dependent nuclease, subunit B Locus tag: lin2368 Name: addA Funciton: ATP-dependent nuclease, subunit A Locus tag: lin2367 Name: yisK Funciton: Conserved hypothetical protein Locus tag: lin2366 Name: PF07457 Funciton: Conserved hypothetical protein
	lin2369	addB	ATP-dependent nuclease, subunit B
	lin2368	addA	ATP-dependent nuclease, subunit A
	lin2367	yisK	Conserved hypothetical protein
	lin2366	PF07457	Conserved hypothetical protein
Position: -42 Score: 5.9 Sequence: TAATAAGAACGTATATTCGGTTTT Locus tag: lin2325 Name: yhaO Funciton: Predicted DNA double-strand break repair protein Locus tag: lin2324 Name: yhaN Funciton: Putative DNA double-strand break repair ATPase Locus tag: lin2323 Name: yhaM Funciton: Predicted 3'-5' exoribonuclease
	lin2325	yhaO	Predicted DNA double-strand break repair protein
	lin2324	yhaN	Putative DNA double-strand break repair ATPase
	lin2323	yhaM	Predicted 3'-5' exoribonuclease
Position: -38 Score: 5.5 Sequence: GAATAAGAACGCTTGTTCGTTTTA Locus tag: lin2082 Name: dinP Funciton: DNA polymerase IV (EC 2.7.7.7)
	lin2082	dinP	DNA polymerase IV (EC 2.7.7.7)
Position: -75 Score: 5.6 Sequence: AAACGCGAACACACTTTCTTTTTT Locus tag: lin1609 Name: dnaE Funciton: DNA polymerase III alpha subunit (EC 2.7.7.7)
	lin1609	dnaE	DNA polymerase III alpha subunit (EC 2.7.7.7)
Position: -44 Score: 5.8 Sequence: AAATAAGAACAAATGTTTGTATGG Locus tag: lin1871 Name: pcrA Funciton: ATP-dependent DNA helicase UvrD/PcrA Locus tag: lin1870 Name: ligA Funciton: DNA ligase (EC 6.5.1.2) Locus tag: lin1869 Name: yerH Funciton: Putative lipoprotein
	lin1871	pcrA	ATP-dependent DNA helicase UvrD/PcrA
	lin1870	ligA	DNA ligase (EC 6.5.1.2)
	lin1869	yerH	Putative lipoprotein
Position: -33 Score: 4.6 Sequence: AAAAAAGAACGTATGTGCGAAAGG Locus tag: lin2426 Name: int Funciton: Integrase
	lin2426	int	Integrase

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulon of LexA in Listeria innocua Clip11262

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --