Regulog HrcA - Streptomycetaceae
| Regulator type: | Transcription factor |
| Regulator family: | HrcA |
| Regulation mode: | repressor |
| Biological process: | Heat shock response |
| Effector: | Heat shock |
| Phylum: | Actinobacteria |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By trascription factor - HrcA
- By taxonomy - Streptomycetaceae
- By TF family - HrcA
- By effector - Heat shock
- By pathway - Heat shock response
| Genome | Genes | Operons |
|---|---|---|
| Streptomyces avermitilis MA-4680 | 6 | 4 |
| Streptomyces coelicolor A3(2) | 6 | 4 |
| Streptomyces griseus subsp. griseus NBRC 13350 | 6 | 4 |
| Streptomyces scabiei 87.22 | 6 | 4 |
| Genes | Function | ||||
|---|---|---|---|---|---|
| CRON 1. | |||||
| COG2331 |
*
Streptomyces avermitilis MA-4680 Site: position = -38 score = 6.71561 sequence = TTAGCACTCACTGAGTGAGAGTGCCAG Gene: SAV_3678: Conserved hypothetical protein |
*
Streptomyces coelicolor A3(2) Site: position = -37 score = 6.638 sequence = TTAGCACTCATCGAGTGAGAGTGCCAG Gene: SCO3187: Conserved hypothetical protein |
*
Streptomyces griseus subsp. griseus NBRC 13350 Site: position = -36 score = 6.47589 sequence = TTAGCACTCATTGAGTGAGAGTGCCAG Gene: SGR_4291: Conserved hypothetical protein |
*
Streptomyces scabiei 87.22 Site: position = -38 score = 6.638 sequence = TTAGCACTCATCGAGTGAGAGTGCCAG Gene: SCAB_53081: Conserved hypothetical protein |
Conserved hypothetical protein |
| CRON 2. | |||||
| groL2 |
*
Streptomyces avermitilis MA-4680 Site: position = -153 score = 6.62413 sequence = TTAGCACTCTGAAGGTGAGAGTGATAA Site: position = -189 score = 6.87439 sequence = CTTGCACTCGGCAGGGGCGAGTGCTAA Gene: SAV_3931: Heat shock protein 60 family chaperone GroEL |
*
Streptomyces coelicolor A3(2) Site: position = -189 score = 6.53625 sequence = CTTGCACTCGACCATGCCGAGTGCTAA Site: position = -153 score = 6.67418 sequence = TTAGCACTCTGAAGGTGAGAGTGACAA Gene: SCO4296: Heat shock protein 60 family chaperone GroEL |
*
Streptomyces griseus subsp. griseus NBRC 13350 Site: position = -190 score = 6.55703 sequence = CTTGCACTCGCAGGGGTCGAGTGCTAA Site: position = -154 score = 6.78709 sequence = TTAGCACTCTCCAGGTGAGAGTGACAG Gene: SGR_3225: Heat shock protein 60 family chaperone GroEL |
*
Streptomyces scabiei 87.22 Site: position = -153 score = 6.67418 sequence = TTAGCACTCTGAAGGTGAGAGTGACAA Site: position = -189 score = 6.82832 sequence = CTTGCACTCGCAGGGGGCGAGTGCTAA Gene: SCAB_50441: Heat shock protein 60 family chaperone GroEL |
Heat shock protein 60 family chaperone GroEL |
| CRON 3. | |||||
| hrcA |
*
Streptomyces avermitilis MA-4680 Site: position = -62 score = 6.70631 sequence = CTGGCACTCGCGCGCGCTGAGTGCCAG Gene: SAV_5569: Heat shock response transcriptional regulator HrcA, HrcA family |
*
Streptomyces coelicolor A3(2) Site: position = -110 score = 6.2101 sequence = CTGGCACTCGCGAGCCATGAGTGCCAG Gene: SCO2555: Heat shock response transcriptional regulator HrcA, HrcA family |
*
Streptomyces griseus subsp. griseus NBRC 13350 Site: position = -62 score = 6.57582 sequence = CTGGCACTCGAACGCACCGAGTGCCAG Gene: SGR_4993: Heat shock response transcriptional regulator HrcA, HrcA family |
*
Streptomyces scabiei 87.22 Site: position = -16 score = 7.2284 sequence = TTGGCACTCGCCCGGGGTGAGTGCCAA Gene: SCAB_61551: Heat shock response transcriptional regulator HrcA, HrcA family |
Heat shock response transcriptional regulator HrcA, HrcA family |
| dnaJ |
Gene: SAV_5570: Chaperone protein DnaJ |
Gene: SCO2554: Chaperone protein DnaJ |
Gene: SGR_4994: Chaperone protein DnaJ |
Gene: SCAB_61561: Chaperone protein DnaJ |
Chaperone protein DnaJ |
| CRON 4. | |||||
| groS |
*
Streptomyces avermitilis MA-4680 Site: position = -124 score = 7.02692 sequence = CTGGCACTCCCCACTGGAGAGTGCCAG Site: position = -171 score = 6.60019 sequence = TTGGCACTCCGCTTGACCGAGTGCTAA Gene: SAV_4991: Heat shock protein 60 family co-chaperone GroES |
*
Streptomyces coelicolor A3(2) Site: position = -173 score = 6.60019 sequence = TTGGCACTCCGCTTGACCGAGTGCTAA Site: position = -126 score = 7.06128 sequence = CTGGCACTCCCCACTGGAGAGTGCCAA Gene: SCO4761: Heat shock protein 60 family co-chaperone GroES |
*
Streptomyces griseus subsp. griseus NBRC 13350 Site: position = -183 score = 6.60019 sequence = TTGGCACTCCGCTTGACCGAGTGCTAA Site: position = -136 score = 7.0976 sequence = CTGGCACTCCCCCCTGGAGAGTGCCAG Gene: SGR_2770: Heat shock protein 60 family co-chaperone GroES |
*
Streptomyces scabiei 87.22 Site: position = -125 score = 7.13196 sequence = CTGGCACTCCCCCCTGGAGAGTGCCAA Site: position = -172 score = 6.09931 sequence = TTAGCAGTCCGCTTGACCGAGTGCTAA Gene: SCAB_36301: Heat shock protein 60 family co-chaperone GroES |
Heat shock protein 60 family co-chaperone GroES |
| groL |
Gene: SAV_4992: Heat shock protein 60 family chaperone GroEL |
Gene: SCO4762: Heat shock protein 60 family chaperone GroEL |
Gene: SGR_2769: Heat shock protein 60 family chaperone GroEL |
Gene: SCAB_36291: Heat shock protein 60 family chaperone GroEL |
Heat shock protein 60 family chaperone GroEL |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |