Regulon of HrcA in Streptomyces scabiei 87.22

Properties
Regulator type:	Transcription factor
TF locus tag:	SCAB_61551
Regulator family:	HrcA
Regulation mode:	repressor
Biological process:	Heat shock response
Effector:	Heat shock
Regulog:	HrcA - Streptomycetaceae
Statistics of regulated genes:
- Genes	6
- Operons	4
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 24 sites [see more]

Member of regulog collections

By trascription factor - HrcA
By taxonomy - Streptomycetaceae
By TF family - HrcA
By effector - Heat shock
By pathway - Heat shock response

Regulated operons
	Locus Tag	Name	Function
Position: -189 Score: 6.8 Sequence: CTTGCACTCGCAGGGGGCGAGTGCTAA Position: -153 Score: 6.7 Sequence: TTAGCACTCTGAAGGTGAGAGTGACAA Locus tag: SCAB_50441 Name: groL2 Funciton: Heat shock protein 60 family chaperone GroEL
	SCAB_50441	groL2	Heat shock protein 60 family chaperone GroEL
Position: -172 Score: 6.1 Sequence: TTAGCAGTCCGCTTGACCGAGTGCTAA Position: -125 Score: 7.1 Sequence: CTGGCACTCCCCCCTGGAGAGTGCCAA Locus tag: SCAB_36301 Name: groS Funciton: Heat shock protein 60 family co-chaperone GroES Locus tag: SCAB_36291 Name: groL Funciton: Heat shock protein 60 family chaperone GroEL
	SCAB_36301	groS	Heat shock protein 60 family co-chaperone GroES
	SCAB_36291	groL	Heat shock protein 60 family chaperone GroEL
Position: -16 Score: 7.2 Sequence: TTGGCACTCGCCCGGGGTGAGTGCCAA Locus tag: SCAB_61551 Name: hrcA Funciton: Heat shock response transcriptional regulator HrcA, HrcA family Locus tag: SCAB_61561 Name: dnaJ Funciton: Chaperone protein DnaJ
	SCAB_61551	hrcA	Heat shock response transcriptional regulator HrcA, HrcA family
	SCAB_61561	dnaJ	Chaperone protein DnaJ
Position: -38 Score: 6.6 Sequence: TTAGCACTCATCGAGTGAGAGTGCCAG Locus tag: SCAB_53081 Name: COG2331 Funciton: Conserved hypothetical protein
	SCAB_53081	COG2331	Conserved hypothetical protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD