Regulon of HrcA in Streptomyces griseus subsp. griseus NBRC 13350

Properties
Regulator type:	Transcription factor
TF locus tag:	SGR_4993
Regulator family:	HrcA
Regulation mode:	repressor
Biological process:	Heat shock response
Effector:	Heat shock
Regulog:	HrcA - Streptomycetaceae
Statistics of regulated genes:
- Genes	6
- Operons	4
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 24 sites [see more]

Member of regulog collections

By trascription factor - HrcA
By taxonomy - Streptomycetaceae
By TF family - HrcA
By effector - Heat shock
By pathway - Heat shock response

Regulated operons
	Locus Tag	Name	Function
Position: -190 Score: 6.6 Sequence: CTTGCACTCGCAGGGGTCGAGTGCTAA Position: -154 Score: 6.8 Sequence: TTAGCACTCTCCAGGTGAGAGTGACAG Locus tag: SGR_3225 Name: groL2 Funciton: Heat shock protein 60 family chaperone GroEL
	SGR_3225	groL2	Heat shock protein 60 family chaperone GroEL
Position: -183 Score: 6.6 Sequence: TTGGCACTCCGCTTGACCGAGTGCTAA Position: -136 Score: 7.1 Sequence: CTGGCACTCCCCCCTGGAGAGTGCCAG Locus tag: SGR_2770 Name: groS Funciton: Heat shock protein 60 family co-chaperone GroES Locus tag: SGR_2769 Name: groL Funciton: Heat shock protein 60 family chaperone GroEL
	SGR_2770	groS	Heat shock protein 60 family co-chaperone GroES
	SGR_2769	groL	Heat shock protein 60 family chaperone GroEL
Position: -62 Score: 6.6 Sequence: CTGGCACTCGAACGCACCGAGTGCCAG Locus tag: SGR_4993 Name: hrcA Funciton: Heat shock response transcriptional regulator HrcA, HrcA family Locus tag: SGR_4994 Name: dnaJ Funciton: Chaperone protein DnaJ
	SGR_4993	hrcA	Heat shock response transcriptional regulator HrcA, HrcA family
	SGR_4994	dnaJ	Chaperone protein DnaJ
Position: -36 Score: 6.5 Sequence: TTAGCACTCATTGAGTGAGAGTGCCAG Locus tag: SGR_4291 Name: COG2331 Funciton: Conserved hypothetical protein
	SGR_4291	COG2331	Conserved hypothetical protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD