Regulog HrcA - Nocardiaceae
| Regulator type: | Transcription factor |
| Regulator family: | HrcA |
| Regulation mode: | repressor |
| Biological process: | Heat shock response |
| Effector: | Heat shock |
| Phylum: | Actinobacteria |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By trascription factor - HrcA
- By taxonomy - Nocardiaceae
- By TF family - HrcA
- By effector - Heat shock
- By pathway - Heat shock response
| Genome | Genes | Operons |
|---|---|---|
| Nocardia farcinica IFM 10152 | 5 | 4 |
| Rhodococcus erythropolis PR4 | 5 | 4 |
| Rhodococcus opacus B4 | 4 | 3 |
| Rhodococcus sp. RHA1 | 5 | 4 |
| Genes | Function | ||||
|---|---|---|---|---|---|
| CRON 1. | |||||
| hsp18 |
*
Nocardia farcinica IFM 10152 Site: position = -85 score = 6.65666 sequence = TTAGCACTCTACCCCGAAGAGTGCTAA Gene: nfa8400: Small heat shock protein 18 |
*
Rhodococcus erythropolis PR4 Site: position = -81 score = 6.61526 sequence = CTGGCACTCAAGGTTGCAGAGTGCCAG Gene: RER_12450: Small heat shock protein 18 |
|
*
Rhodococcus sp. RHA1 Site: position = -101 score = 6.76842 sequence = CTGGCACTCTCGGGTGCCGAGTGCTAA Gene: RHA1_ro06632: Small heat shock protein 18 |
Small heat shock protein 18 |
| CRON 2. | |||||
| COG2331 |
*
Nocardia farcinica IFM 10152 Site: position = -52 score = 6.74829 sequence = TTGGCACTGTCGGCGGTAGAGTGCTAG Gene: nfa49550: conserved hypothetical protein |
*
Rhodococcus erythropolis PR4 Site: position = -81 score = 6.67589 sequence = TTGGCACTGTCACTTGTAGAGTGCTAA Gene: RER_43910: conserved hypothetical protein |
*
Rhodococcus opacus B4 Site: position = -63 score = 6.82998 sequence = TTGGCACTGTCGGCTGTAGAGTGCTAA Gene: ROP_56950: conserved hypothetical protein |
*
Rhodococcus sp. RHA1 Site: position = -64 score = 6.88816 sequence = TTGGCACTGTCGACTGTAGAGTGCTAA Gene: RHA1_ro05630: conserved hypothetical protein |
conserved hypothetical protein |
| CRON 3. | |||||
| groL2 |
*
Nocardia farcinica IFM 10152 Site: position = -166 score = 7.00459 sequence = TTGGCACTCTCGACCTGTGAGTGCCAG Site: position = -201 score = 6.31019 sequence = CTTGCACTCGCCACCCCCGAGTGCTAG Gene: nfa52750: Heat shock protein 60 family chaperone GroEL |
*
Rhodococcus erythropolis PR4 Site: position = -265 score = 6.32887 sequence = CTTGCACTCGGCACGCTCGAGTGCTAA Site: position = -230 score = 6.80729 sequence = TTGGCACTCGCGAACCGTGAGTGCCAG Gene: RER_15260: Heat shock protein 60 family chaperone GroEL |
*
Rhodococcus opacus B4 Site: position = -200 score = 6.34001 sequence = CTTGCACTCACCCTGTTCGAGTGCTAA Site: position = -165 score = 6.93 sequence = TTGGCACTCGCCGCGGGTGAGTGCCAG Gene: ROP_18630: Heat shock protein 60 family chaperone GroEL |
*
Rhodococcus sp. RHA1 Site: position = -165 score = 6.9839 sequence = TTGGCACTCACGACGCGTGAGTGCCAG Site: position = -200 score = 6.21372 sequence = CTTGCACTCACCCTGTCCGAGTGCTAA Gene: RHA1_ro02146: Heat shock protein 60 family chaperone GroEL |
Heat shock protein 60 family chaperone GroEL |
| CRON 4. | |||||
| groS |
*
Nocardia farcinica IFM 10152 Site: position = -223 score = 6.59533 sequence = CTGGCACTCTCGTGTATAGAGTGCTAG Gene: nfa8860: Heat shock protein 60 family co-chaperone GroES |
*
Rhodococcus erythropolis PR4 Site: position = -151 score = 7.01365 sequence = TTGGCACTCTCACGTATAGAGTGCCAA Gene: RER_19230: Heat shock protein 60 family co-chaperone GroES |
*
Rhodococcus opacus B4 Site: position = -150 score = 7.01365 sequence = TTGGCACTCTCACGTATAGAGTGCCAA Gene: ROP_62490: Heat shock protein 60 family co-chaperone GroES |
*
Rhodococcus sp. RHA1 Site: position = -150 score = 7.01365 sequence = TTGGCACTCTCACGTATAGAGTGCCAA Gene: RHA1_ro06189: Heat shock protein 60 family co-chaperone GroES |
Heat shock protein 60 family co-chaperone GroES |
| groL |
Gene: nfa8870: Heat shock protein 60 family chaperone GroEL |
Gene: RER_19240: Heat shock protein 60 family chaperone GroEL |
Gene: ROP_62500: Heat shock protein 60 family chaperone GroEL |
Gene: RHA1_ro06190: Heat shock protein 60 family chaperone GroEL |
Heat shock protein 60 family chaperone GroEL |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |