Regulon of HrcA in Rhodococcus opacus B4

Properties
Regulator type:	Transcription factor
TF locus tag:	ROP_09680
Regulator family:	HrcA
Regulation mode:	repressor
Biological process:	Heat shock response
Effector:	Heat shock
Regulog:	HrcA - Nocardiaceae
Statistics of regulated genes:
- Genes	4
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 19 sites [see more]

Member of regulog collections

By trascription factor - HrcA
By taxonomy - Nocardiaceae
By TF family - HrcA
By effector - Heat shock
By pathway - Heat shock response

Regulated operons
	Locus Tag	Name	Function
Position: -150 Score: 7 Sequence: TTGGCACTCTCACGTATAGAGTGCCAA Locus tag: ROP_62490 Name: groS Funciton: Heat shock protein 60 family co-chaperone GroES Locus tag: ROP_62500 Name: groL Funciton: Heat shock protein 60 family chaperone GroEL
	ROP_62490	groS	Heat shock protein 60 family co-chaperone GroES
	ROP_62500	groL	Heat shock protein 60 family chaperone GroEL
Position: -200 Score: 6.3 Sequence: CTTGCACTCACCCTGTTCGAGTGCTAA Position: -165 Score: 6.9 Sequence: TTGGCACTCGCCGCGGGTGAGTGCCAG Locus tag: ROP_18630 Name: groL2 Funciton: Heat shock protein 60 family chaperone GroEL
	ROP_18630	groL2	Heat shock protein 60 family chaperone GroEL
Position: -63 Score: 6.8 Sequence: TTGGCACTGTCGGCTGTAGAGTGCTAA Locus tag: ROP_56950 Name: COG2331 Funciton: conserved hypothetical protein
	ROP_56950	COG2331	conserved hypothetical protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD