Regulon of HrcA in Nocardia farcinica IFM 10152

Properties
Regulator type:	Transcription factor
TF locus tag:	nfa14250
Regulator family:	HrcA
Regulation mode:	repressor
Biological process:	Heat shock response
Effector:	Heat shock
Regulog:	HrcA - Nocardiaceae
Statistics of regulated genes:
- Genes	5
- Operons	4
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 19 sites [see more]

Member of regulog collections

By trascription factor - HrcA
By taxonomy - Nocardiaceae
By TF family - HrcA
By effector - Heat shock
By pathway - Heat shock response

Regulated operons
	Locus Tag	Name	Function
Position: -201 Score: 6.3 Sequence: CTTGCACTCGCCACCCCCGAGTGCTAG Position: -166 Score: 7 Sequence: TTGGCACTCTCGACCTGTGAGTGCCAG Locus tag: nfa52750 Name: groL2 Funciton: Heat shock protein 60 family chaperone GroEL
	nfa52750	groL2	Heat shock protein 60 family chaperone GroEL
Position: -52 Score: 6.7 Sequence: TTGGCACTGTCGGCGGTAGAGTGCTAG Locus tag: nfa49550 Name: COG2331 Funciton: conserved hypothetical protein
	nfa49550	COG2331	conserved hypothetical protein
Position: -85 Score: 6.7 Sequence: TTAGCACTCTACCCCGAAGAGTGCTAA Locus tag: nfa8400 Name: hsp18 Funciton: Small heat shock protein 18
	nfa8400	hsp18	Small heat shock protein 18
Position: -223 Score: 6.6 Sequence: CTGGCACTCTCGTGTATAGAGTGCTAG Locus tag: nfa8860 Name: groS Funciton: Heat shock protein 60 family co-chaperone GroES Locus tag: nfa8870 Name: groL Funciton: Heat shock protein 60 family chaperone GroEL
	nfa8860	groS	Heat shock protein 60 family co-chaperone GroES
	nfa8870	groL	Heat shock protein 60 family chaperone GroEL

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD