Regulog ModE2 - Comamonadaceae

Member of regulog collections
- By trascription factor - ModE
- By taxonomy - Comamonadaceae
- By TF family - ModE
- By effector - Molybdate
- By pathway - Molybdopterin biosynthesis
Genome | Genes | Operons |
---|---|---|
Acidovorax avenae subsp. citrulli AAC00-1 | ||
Acidovorax sp. JS42 | ||
Comamonas testosteroni KF-1 | 3 | 2 |
Delftia acidovorans SPH-1 | 4 | 2 |
Leptothrix cholodnii SP-6 | ||
Methylibium petroleiphilum PM1 | ||
Polaromonas naphthalenivorans CJ2 | ||
Polaromonas sp. JS666 | 4 | 2 |
Rhodoferax ferrireducens DSM 15236 | ||
Variovorax paradoxus S110 | 3 | 1 |
Verminephrobacter eiseniae EF01-2 | 1 | 1 |
Genes | Function | |||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|
CRON 1. | ||||||||||||
modB |
|
|
Gene: CtesDRAFT_0893: Molybdenum transport system permease protein ModB (TC 3.A.1.8.1) |
Gene: Daci_3882: Molybdenum transport system permease protein ModB (TC 3.A.1.8.1) |
|
|
|
Gene: Bpro_2498: Molybdenum transport system permease protein ModB (TC 3.A.1.8.1) |
|
*
Variovorax paradoxus S110 Site: position = -14 score = 5.54595 sequence = TGCGTTGTATCTTCATGAATACGACGAA Gene: Vapar_4070: Molybdenum transport system permease protein ModB (TC 3.A.1.8.1) |
|
Molybdenum transport system permease protein ModB (TC 3.A.1.8.1) |
modA |
|
|
*
Comamonas testosteroni KF-1 Site: position = -68 score = 5.88236 sequence = AGTGTTATATTCCGTCAAATATAACGTG Gene: CtesDRAFT_0892: Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1) |
*
Delftia acidovorans SPH-1 Site: position = -75 score = 5.69438 sequence = TTCATCGTATACGATTGAATATTTCGTA Gene: Daci_3883: Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1) |
|
|
|
*
Polaromonas sp. JS666 Site: position = -99 score = 6.93968 sequence = TTCGCTATATTCCATTAAATATAGCGAA Gene: Bpro_2497: Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1) |
|
Gene: Vapar_4069: Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1) |
|
Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1) |
modC |
|
|
|
|
|
|
|
Gene: Bpro_2499: Molybdenum transport ATP-binding protein ModC (TC 3.A.1.8.1) |
|
Gene: Vapar_4068: Molybdenum transport ATP-binding protein ModC (TC 3.A.1.8.1) |
|
Molybdenum transport ATP-binding protein ModC (TC 3.A.1.8.1) |
CRON 2. | ||||||||||||
modE2 |
|
|
Gene: CtesDRAFT_0896: Molybdate-responsive transcriptional regulator ModE2, ModE family |
*
Delftia acidovorans SPH-1 Site: position = -60 score = 4.23549 sequence = TTCGCTGTAGCGATCCATGCATTGCGTA Gene: Daci_4259: Molybdate-responsive transcriptional regulator ModE2, ModE family |
|
|
|
*
Polaromonas sp. JS666 Site: position = -103 score = 6.93968 sequence = TTCGCTATATTTAATGGAATATAGCGAA Gene: Bpro_2496: Molybdate-responsive transcriptional regulator ModE2, ModE family |
|
Gene: Vapar_4071: Molybdate-responsive transcriptional regulator ModE2, ModE family |
*
Verminephrobacter eiseniae EF01-2 Site: position = -212 score = 6.00212 sequence = TACGTCGTATTCCATCGGATATGTCAAA Gene: Veis_3515: Molybdate-responsive transcriptional regulator ModE2, ModE family |
Molybdate-responsive transcriptional regulator ModE2, ModE family |
COG1720 |
|
|
*
Comamonas testosteroni KF-1 Site: position = -50 score = 5.88236 sequence = CACGTTATATTTGACGGAATATAACACT Gene: CtesDRAFT_0891: Conserved hypothetical protein |
Gene: Daci_4260: Conserved hypothetical protein |
|
|
|
|
|
|
|
Conserved hypothetical protein |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
![]() |
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
![]() |
Regulatory Sites | [ FASTA format ] | DOWNLOAD |