Regulon of ModE2 in Verminephrobacter eiseniae EF01-2

Properties
Regulator type:	Transcription factor
TF locus tag:	Veis_3515
Regulator family:	ModE
Regulation mode:	repressor (activator)
Biological process:	Molybdopterin biosynthesis
Effector:	Molybdate
Regulog:	ModE2 - Comamonadaceae
Statistics of regulated genes:
- Genes	1
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 8 sites [see more]

Member of regulog collections

By trascription factor - ModE
By taxonomy - Comamonadaceae
By TF family - ModE
By effector - Molybdate
By pathway - Molybdopterin biosynthesis

Regulated operons
	Locus Tag	Name	Function
Position: -212 Score: 6 Sequence: TACGTCGTATTCCATCGGATATGTCAAA Locus tag: Veis_3515 Name: modE2 Funciton: Molybdate-responsive transcriptional regulator ModE2, ModE family
	Veis_3515	modE2	Molybdate-responsive transcriptional regulator ModE2, ModE family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD