Regulon of ModE2 in Delftia acidovorans SPH-1

Properties
Regulator type:	Transcription factor
TF locus tag:	Daci_4259
Regulator family:	ModE
Regulation mode:	repressor (activator)
Biological process:	Molybdopterin biosynthesis
Effector:	Molybdate
Regulog:	ModE2 - Comamonadaceae
Statistics of regulated genes:
- Genes	4
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 8 sites [see more]

Member of regulog collections

By trascription factor - ModE
By taxonomy - Comamonadaceae
By TF family - ModE
By effector - Molybdate
By pathway - Molybdopterin biosynthesis

Regulated operons
	Locus Tag	Name	Function
Position: -75 Score: 5.7 Sequence: TTCATCGTATACGATTGAATATTTCGTA Locus tag: Daci_3883 Name: modA Funciton: Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1) Locus tag: Daci_3882 Name: modB Funciton: Molybdenum transport system permease protein ModB (TC 3.A.1.8.1)
	Daci_3883	modA	Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1)
	Daci_3882	modB	Molybdenum transport system permease protein ModB (TC 3.A.1.8.1)
Position: -60 Score: 4.2 Sequence: TTCGCTGTAGCGATCCATGCATTGCGTA Locus tag: Daci_4259 Name: modE2 Funciton: Molybdate-responsive transcriptional regulator ModE2, ModE family Locus tag: Daci_4260 Name: COG1720 Funciton: Conserved hypothetical protein
	Daci_4259	modE2	Molybdate-responsive transcriptional regulator ModE2, ModE family
	Daci_4260	COG1720	Conserved hypothetical protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD